Skip to main content
Canna~Fangled Abstracts

Endocannabinoids in amygdala and nucleus accumbens mediate social play reward in adolescent rats

By August 9, 2013No Comments
pub med big
Logo of nihpa

J Neurosci. Author manuscript; available in PMC 2013 April 24.
Published in final edited form as:
PMCID: PMC3496852
NIHMSID: NIHMS417338

Endocannabinoids in amygdala and nucleus accumbens mediate social play reward in adolescent rats

The publisher’s final edited version of this article is available free at J Neurosci

Abstract

The brain endocannabinoid system plays a crucial role in emotional processes. We have previously identified an important role for endocannabinoids in social play behavior, a highly rewarding form of social interaction in adolescent rats. Here, we tested the hypothesis that endocannabinoid modulation of social play behavior occurs in brain regions implicated in emotion and motivation. Social play increased levels of the endocannabinoid anandamide in the amygdala and nucleus accumbens (NAc), but not in prefrontal cortex or hippocampus of 4–5 week old male Wistar rats. Furthermore, social play increased phosphorylation of CB1 cannabinoid receptors in the amygdala. Systemic administration of the anandamide hydrolysis inhibitor URB597 increased social play behavior, and augmented the associated elevation in anandamide levels in the amygdala, but not the NAc. Infusion of URB597 into the basolateral amygdala (BLA) increased social play behavior, and blockade of BLA CB1 cannabinoid receptors with the antagonist/inverse agonist SR141716A prevented the play-enhancing effects of systemic administration of URB597. Infusion of URB597 into the NAc also increased social play, but blockade of NAc CB1 cannabinoid receptors did not antagonize the play-enhancing effects of systemic URB597 treatment. Last, SR141716A did not affect social play after infusion into the core and shell subregions of the NAc, while it reduced social play when infused into the BLA. These data show that increased anandamide signalling in the amygdala and NAc augments social play, and identify the BLA as a prominent site of action for endocannabinoids to modulate the rewarding properties of social interactions in adolescent rats.

Keywords: social behavior, cannabinoids, amygdala, nucleus accumbens, reward, adolescence

INTRODUCTION

The endocannabinoid system is a unique neuromodulatory system in mammalian physiology. It consists of cannabinoid receptors (CB1 and CB2, mainly expressed in the brain and periphery, respectively), their endogenous ligands (endocannabinoids, including anandamide and 2-arachidonoylglycerol (2-AG)) and the enzymes for ligand synthesis and degradation (Freund et al., 2003Piomelli, 2003Di Marzo, 2006Pacher et al., 2006). Endocannabinoids are key modulators of emotions, and altered endocannabinoid signalling has been implicated in several psychiatric disorders (Wotjak, 2005;Laviolette and Grace, 2006Pacher et al., 2006Di Marzo, 2008Leweke and Koethe, 2008Lutz, 2009;Marco et al., 2011).

Cannabinoids have been implicated in aspects of emotion, motivation and learning (Wotjak, 2005;Viveros et al., 2007Solinas et al., 2008Berridge et al., 2010Fattore et al., 2010Zanettini et al., 2011). Therefore, we have investigated their role in social play behavior. Social play, a characteristic social behavior in young mammals, is essential for the development of physical, cognitive and social capacities (Panksepp et al., 1984Vanderschuren et al., 1997Pellis and Pellis, 2009Trezza et al., 2010). Social play is highly rewarding: it is an incentive for maze learning, lever pressing and place conditioning in rats and primates (Falk, 1958Mason et al., 1963Humphreys and Einon, 1981Normansell and Panksepp, 1990Calcagnetti and Schechter, 1992Ikemoto and Panksepp, 1992Douglas et al., 2004;Thiel et al., 2008; –2009Trezza et al., 2009; –2011a, for review see Trezza et al., 2011b). Furthermore, it is modulated through neurotransmitters (Vanderschuren et al., 1997Trezza et al., 2010Siviy and Panksepp, 2011) implicated in the motivational properties of food and drugs, such as dopamine, or their pleasurable characteristics, such as endogenous opioids and endocannabinoids (Berridge and Robinson, 1998Peciña and Berridge, 2005Salamone et al., 2005Barbano and Cador, 2007Mahler et al., 2007;Solinas et al., 2008). We have previously shown that systemic administration of drugs that increase endocannabinoid signalling by blocking endocannabinoid deactivation enhances social play, through interaction with opioid and dopaminergic neurotransmission (Trezza and Vanderschuren, 2008a; –2008b; –2009). This suggests that during social play, endocannabinoids are released in brain areas that mediate this behavior and that increased endocannabinoid activity facilitates social play. However, the brain areas within which endocannabinoids exert their effects on social play are unknown. CB1 cannabinoid receptors are abundant in brain areas involved in emotion and motivation, such as the nucleus accumbens (NAc) and amygdala (Katona et al., 2001Tsou et al., 1998). Indeed, endocannabinoids in the NAc modulate the rewarding properties of food and drugs (van der Stelt and Di Marzo, 2003Gardner, 2005Mahler et al., 2007Soria-Gomez et al., 2007Orio et al., 2009;Shinohara et al., 2009Berridge et al., 2010). Furthermore, endocannabinoids in the amygdala regulate affective states, stress responses and emotional learning (Marsicano et al., 2002Laviolette and Grace, 2006Campolongo et al., 2009Hill et al., 2010; McLaughlin and Gobbi, 2011). Therefore, we hypothesized that the stimulatory effects of endocannabinoids on social play are mediated within the NAc and the amygdala.

MATERIALS AND METHODS

Animals

Male Wistar rats (Charles River, Sulzfeld, Germany or Charles River, Calco, Italy) arrived in our animal facility at 21 days of age and were housed in groups of four in 40 × 26 × 20 (l × w × h) Macrolon cages under controlled conditions (temperature 20–21 °C, 60–65% relative humidity and 12/12 h light cycle with lights on at 7.00 a.m.). Food and water were available ad libitum.

All animals used were experimentally naive. The experiments were approved either by the Animal Ethics Committee of Utrecht University and conducted in agreement with Dutch laws (Wet op de Dierproeven, 1996), or were in accordance with the guidelines released by the Italian Ministry of Health (D.L. 116/92). All experiments were in accordance with the European Communities Council Directive of November 24, 1986 (86/609/EEC).

Surgery

At 28 days of age, rats were anesthetized with 0.08ml/100g (s.c.) Hypnorm® (fentanylcitrate 0.315 mg/ml and fluanison 10 mg/ml, Janssen, Belgium) and positioned into a stereotaxic frame (David Kopf Instruments, USA). Guide cannulas, consisting of 24 gauge thinwalled stainless steel tubing (Cooper’s Needleworks, UK), were implanted bilaterally, aimed 1.0 mm above the NAc [border between the shell and core subregions; coordinates: anteroposterior (AP), +1.5 mm from bregma; mediolateral (ML), ±1.9 mm from the midline; dorsoventral (DV), −7.0 mm from skull surface]. Other groups of rats were implanted with bilateral guide cannulas (24 gauge) aimed 1.0 mm above the NAc core [coordinates: AP, +1.5 mm; ML, ±1.9 mm; DV, −6.5 mm], NAc shell [coordinates: AP, +1.8 mm; ML, ±2.8 mm; DV, −7.5 mm, 10° angle] or the basolateral amygdala (BLA) [coordinates: AP, −1.9 mm; ML, ±4.6 mm; DV, −7.5 mm]. Coordinates for each brain region were based on our previous studies (Trezza et al., 2011a) or determined by pilot placement experiments in 28-day-old rats using the atlas of Paxinos and Watson (Paxinos and Watson, 2007). Cannulas were secured with stainless steel screws and dental acrylic; 29 gauge wire stylets (Cooper’s Needleworks, UK) were inserted into the guide cannulas to maintain patency. After surgery, rats were individually housed and allowed to recover for 4 days. On the fifth day, they were re-housed in groups of four with their original cage mates. Behavioral testing began one week after surgery.

Drugs and infusion procedures

The indirect cannabinoid agonist URB597 (Cayman Chemical, Ann Arbor, MI, USA), which inhibits fatty acid amide hydrolase (FAAH), the enzyme that degrades the endocannabinoid anandamide (Kathuria et al., 2003), and the CB1 cannabinoid receptor antagonist/inverse agonist SR141716A (National Institute of Mental Health’s Chemical Synthesis and Drug Supply Program, Bethesda, MD, USA) were dissolved in 5% Tween-80/5% polyethylene glycol/saline. Bilateral infusions of drugs or an equivalent volume of the corresponding vehicle were made using 30-gauge injection needles (Bilaney, Germany) connected to 10-μl Hamilton microsyringes by polyethylene (PE-20) tubing. The injection needles protruded 1.0 mm beyond the cannula tips, and a 0.3 (for NAc) or 0.2 μl (for BLA) injection volume per hemisphere was infused over 60 s using a syringe pump (model 975A; Harvard Apparatus, USA). The injection needles remained within the guide cannulas for 60 s following drug infusion to facilitate diffusion and to prevent backflow of drug along the cannula track. After infusions, stylets were replaced, and the animals were left in a holding cage for 5 min before testing.

Histological confirmation of injection sites

Injection sites were verified as previously described (Mahler et al., 2007Simmons and Self, 2009;Trezza et al., 2011a). After testing, animals were euthanized by carbon dioxide inhalation and microinjected with 0.3 μl of black ink over 60 s through the guide cannulas. Animals were immediately decapitated and their brains removed. Slices (20 μm thick) were collected throughout the forebrain and analyzed under a dissecting microscope for the location of the infusion sites according to the atlas of Paxinos and Watson (Paxinos and Watson, 2007). Only pairs in which both animals had bilateral needle tracks terminating into the target area and no damage to the target tissues were included in the final analysis.

Behavioral testing

 

Social play behavior

All the experiments were performed in a sound attenuated chamber under dim light conditions. The testing arena consisted of a Plexiglas cage measuring 40 × 40 × 60 cm (l × w × h), with approximately 2 cm of wood shavings covering the floor. The behaviors of the animals were recorded using a camera with zoom lens, video tape recorder and television monitor. The animals in a test pair did not differ by more than 10 g in body weight and had no previous common social experience.

To measure play- and/or URB597-induced changes in endocannabinoid levels (Fig. 1), 28-day-old rats were individually habituated to the test cage for 10 min on each of the 2 days before testing, as previously described (Trezza and Vanderschuren, 2008ab2009). On the test day, the animals were isolated for 3.5 h before testing, to enhance their social motivation and thus facilitate the expression of social play behavior during testing (Niesink and Van Ree, 1989Vanderschuren et al., 19952008). Two hours before testing, the rats were treated with URB597 (0.1 mg/kg, i.p.) or vehicle. The test consisted of placing the animals, either alone or together with a similarly treated partner, into the test cage for 15 min. Thus, the following four groups of animals were tested: 1. animals treated with vehicle and placed alone in the test cage, 2. animals treated with vehicle and placed in the test cage together with a vehicle-treated partner, 3. animals treated with URB597 and placed alone in the test cage, 4. animals treated with URB597 and placed in the test cage together with a URB597-treated partner.

Figure 1

Endocannabinoid levels in NAc, amygdala, prefrontal cortex and hippocampus of adolescent rats treated with either URB597 or vehicle, and placed in the test cage either alone or together with a play partner

To measure play-induced changes in the expression of phosphorylated and total CB1 cannabinoid receptors and FAAH and NAPE-PLD expression (Fig. 2), 28-day-old rats were individually habituated to the test cage for 10 min on each of the 2 days before testing. On the test day, the animals were isolated for 3.5 h before testing, treated with vehicle and placed in the test cage either alone or together with a vehicle-treated partner for 15 min.

Figure 2

Western blot analysis of phosphorylated and total CB1 receptor protein expression in NAc and amygdala

To investigate the role of the NAc and the BLA in the play-enhancing effect of URB597, the following procedure was used. One week after surgery (35 days of age), rats equipped with bilateral guide cannulas were habituated to the experimental procedures on two consecutive days, as previously described (Trezza et al., 2011a). On the first habituation day, they were individually placed into the test cage for 10 min, and on the second habituation day, they were isolated for 2 h. Pairs of rats were then infused with a vehicle solution and placed into the test cage for 15 min, to habituate them to the infusion procedures and determine baseline levels of social play behavior. On the test day, the animals were isolated for 2 h before testing. Pairs of rats were then infused simultaneously with either vehicle or drug solutions and placed into the test cage for 15 min. In the experiments shown in Fig. 3a–b and 5a–b, animals received intra-NAc or intra-BLA infusions of URB597 (0.005–0.01 μg/hemisphere), respectively. In the experiments shown in Fig. 3c–d and 5c–d, animals were treated intraperitoneally with URB597 (0.1 mg/kg) or its vehicle 2 h before infusion of SR141716A (1 and 0.1 μg/hemisphere in the NAc and BLA, respectively) or its vehicle into either NAc (Fig. 3c–d) or BLA (Fig. 5c–d). In the experiments shown in Fig. 4a–f and 5e–f, animals received intra-NAc (border core/shell, core, or shell) or intra-BLA infusions of SR14171A (0.03–3.0 μg/hemisphere), respectively.

Figure 3

Infusion of the anandamide hydrolysis inhibitor URB597 into the NAc enhanced social play. However, blockade of NAc cannabinoid receptors did not antagonize the effects of systemic URB597 administration on social play
Figure 4

Blockade of NAc cannabinoid receptors did not affect social play
Figure 5

Infusion of URB597 into the amygdala enhanced social play. Blockade of amygdala cannabinoid receptors antagonized the effects of systemic URB597 administration and reduced social play

Behavior was assessed per pair of animals using the Observer 3.0 software (Noldus Information Technology B.V., The Netherlands). The following behavioral elements were scored per 15 min (Panksepp et al., 1984Vanderschuren et al., 1997Pellis and Pellis, 2009Trezza et al., 2010):

  • frequency of pinning: one animal lying with its dorsal surface on the floor with the other animal standing over it. This is the most characteristic posture in social play in rats, that occurs when one animal is solicited to play by its test partner and rotates to its dorsal surface to prolong the playful interaction
  • frequency of pouncing: this is an index of play solicitation, i.e., one animal is soliciting the other to play, by attempting to nose or rub the nape of the neck of the test partner
  • time spent in social exploration: sniffing any part of the body of the test partner, including the anogenital area.
 

Neurochemical experiments

Changes in endocannabinoid levels after social play were assessed using ex vivo isotope dilution liquid chromatography-atmospheric pressure chemical ionization-mass spectrometric analysis (Guidali et al., 2011). Endocannabinoids act as local mediators and retrograde neuromodulators in the brain, being biosynthesized and immediately released from cells. This means that there are no pre-formed endocannabinoids stored in vesicles. Therefore, what is measured in small amounts of tissue reflects what is biosynthesized and what is needed to stimulate local cannabinoid receptors. Differences in endocannabinoid concentrations before and after certain events then reflect stimulus-induced phasic cannabinoid receptor stimulation. Although in vivo microdialysis has the advantage of allowing for repeated measures in the same animal and direct correlations of endocannabinoid levels with behavioural parameters, it likely produces results that are comparable to ex vivo tissue measurements in terms of stimulus-induced endocannabinoid release. In addition, the energetic nature of social play behavior, with animals vigorously chasing, pouncing and rolling onto their backs is hardly compatible with being connected to tubing and a swivel, which is necessary for in vivo microdialysis.

Immediately after testing for social play behavior, rats were rapidly decapitated, their brains quickly removed and rinsed in ice-cold distilled water for 10 s. The brains were then cut into coronal slices on a cold plate, and the NAc, amygdala, hippocampus and prefrontal cortex were dissected by hand under microscopic control within 2 min. Tissues were stored at −80 °C until use.

Measurement of endocannabinoid levels

The extraction, purification and quantification of anandamide, 2-arachidonoylglycerol (2-AG), oleoylethanolamide (OEA) and palmitoylethanolamide (PEA) in serum was performed as described previously (Marsicano et al., 2002Guidali et al., 2011). After addition of 5 pmol of the respective deuterated internal standards, repeated (three times) lipid extraction of the latter with chloroform:methanol (2:1 by vol), and pre-purification of the lipid extracts on silica mini-columns eluted with chloroform:methanol (9:1 by vol), chromatographic fractions containing the compounds were subjected to isotope dilution liquid chromatography-atmospheric pressure chemical ionization-mass spectrometric analysis as described previously (Guidali et al., 2011). Tissue concentrations of endocannabinoids or PEA and OEA are reported in pmol/g wet tissue weight.

Western blot analysis of phosphorylated and total CB1 cannabinoid receptor

Rat brain punches were grinded in ice-cold lysis buffer (50 mM Tris-HCl, pH 7.4, 10% w/v sucrose, 5 mM EDTA, 1 mM DTT, 1% w/v SDS, protease inhibitors (Roche) and phosphatase inhibitors (Sigma)) (Orio et al., 2009). After centrifugation at 14,000 rpm at 4°C for 30 min, supernatant was collected and total protein concentration was measured using a detergent-compatible protein assay (Bio-Rad). The protein separation and western blotting were performed as described previously with minor modifications (Zhou et al., 2011). Briefly, 20 μg of total protein from each sample was loaded on a 10% SDS-PAGE gel. Following separation in gel, proteins were transferred onto nitrocellulose membrane (Hybond-C Extra, Amersham). The membrane was blocked for 1 hr in 5% nonfat milk in TBS-T (50 mM Tris pH 7.5, 150 mM NaCl and 0.1% Tween20), followed by overnight primary antibody incubation at 4°C. Anti-CB1 (1:500 dilution in TBS-T) and anti-α-tubulin (1:2000 dilution in TBS-T) were purchased from Sigma, and anti-pCB1 (Ser 316) (1:250 dilution in TBS-T) was from Santa Cruz. After 3 washes, the membrane was incubated with species-specific secondary antibodies (Horseradish Peroxidase (HRP)-conjugated) for 1 hr at room temperature. Chemiluminescence from Supersignal substrate (Thermo Scientific) was detected by CL-XPosure Film (Thermo Scientific). The intensity of the protein bands was quantified using ImageJ software (NIH).

qPCR analysis of FAAH and NAPE-PLD expression

Total RNA was extracted from the dissected brain regions using Trizol (Invitrogen) according to manufactor’s recommendations. DNAse treatment (Roche) was performed to remove genomic DNA. Integrity and concentration of RNA were checked using Nanodrop spectrophotometer (Thermo Scientific) and gel electrophoresis. RNA (0.25 μg) was reverse transcribed with random primers using the Taqman reverse transcriptase reagents kit (Promega) according to manufactor’s protocol in a volume of 25 μl. Primers were designed using Primer3 (Rozen and Skaletsky, 2000). All primers were checked for gene specificity by BLAST searching. In addition, all PCR reactions were checked for specificity using the melting curve analysis (StepOne Software V2.0, Applied Biosystems). The following primers were used: FAAH (GenBank: NM_024132.3) forward primer: TGCTGAAGCCTCTGTTTCCT, reverse primer: TCTCATGCTGCAGTTTCCAC; NAPE-PLD (GenBank: NM_199381.1) forward primer: TCGCTGGGGATACTGGTTAC, reverse primer: AAGCTCCAATGGGAATAGCC. qPCR reactions were performed in a reaction volume of 10 μl with SYBR green master mix (Applied Biosystems) and cDNA corresponding to ~ 4ng RNA. Cycle settings were 60 °C 2 min, 95 °C 2 min, 40 cycles of 95 °C 15 sec and 60 °C 45 sec, followed by dissociation steps of 0.3 °C from 60 °C to 95 °C. To correct for differences of input amounts of RNA a normalization factor was used. This normalization factor was calculated as the geometric mean of two stable housekeeping genes, GAPDH and β-actin. The following primers were used: GAPDH (Genbank: NM_017008) forward primer: GCTACAGCTTCACCACCACA, reverse primer: GCCATCTCTTGCTCGAAGTC; β-actin (Genbank: NM_031144) forward primer: TGCACCACCAACTGCTTAGC, reverse primer: GGCATGGACTGTGGTCATGA.

Statistical analysis

Pinning and pouncing frequencies and time spent in social exploration were expressed as mean ± SEM. To assess the effects of single treatments on social play behavior, data were analyzed using either one-way analysis of variance (ANOVA) followed by Student-Newman-Keuls post-hoc test, or Student’s t-test. To assess the effects of combined treatments on social play behavior, data were analyzed using two-way ANOVA, followed by Student-Newman-Keuls post-hoc test. To assess the effects of social play behavior and URB597 administration on endocannabinoid levels, data were analyzed using two-way ANOVA, using treatment (URB597 or vehicle) and test condition (tested alone or together with a play partner) as between-subjects factors. Two-way ANOVA was followed by Student-Newman-Keuls post-hoc test. To assess the effects of social play behavior on total and phosphorylated CB1 receptors, FAAH and NAPE-PLD expression, data were analysed by Student’s t-test.

RESULTS

Social play- and/or URB597-induced changes in brain endocannabinoid levels

To determine which brain regions mediate endocannabinoid modulation of social play, we measured endocannabinoid levels in NAc, amygdala, prefrontal cortex and hippocampus in adolescent rats treated systemically with either URB597 or vehicle, and sacrificed immediately after being placed either alone or together with a play partner in the test cage for 15 min.

In line with previous findings (Trezza and Vanderschuren, 2008ab), systemic administration of URB597 increased social play (pinning: t=−2.7, df=8, p<0.05], Fig. 1a; pouncing: [t=−3.47, df=8, p<0.01], Fig. 1b). A two-way ANOVA performed on NAc anandamide levels in animals treated with either URB597 or vehicle, and placed either alone or together with a play partner in the test cage, gave the following results: [F(testcondition)1,16=4.53, p<0.05; F(treatment) 1,16=3, n.s.; F(test condition × treatment) 1,16=2.21, n.s]. Post hoc analysis showed that the opportunity to engage in social play increased NAc anandamide levels in vehicle-treated rats (Fig. 1c). In addition, URB597 administration increased NAc anandamide levels irrespective of whether animals were placed alone or together with a play partner in the test cage (Fig. 1c). A two-way ANOVA performed on anandamide levels in the amygdala gave the following results: [F(test condition)1,16=14.36, p<0.01; F(treatment) 1,16=8.81, p<0.01; F(test condition × treatment) 1,16=0.12, n.s]. Post hoc analysis showed that vehicle-treated rats allowed to interact with a play partner for 15 min had higher anandamide levels in the amygdala than vehicle-treated rats placed alone in the test cage (Fig. 1d). Animals treated with URB597 and placed alone in the test cage had slightly increased anandamide levels compared to vehicle-treated animals in the same experimental condition (p=0.08). Importantly, anandamide levels in the amygdala further increased in animals treated with URB597 and allowed to interact with a play partner during the test session (Fig. 1d), showing that social play and URB597 administration had additive effects on anandamide levels in the amygdala.

Social play and/or URB597 administration did not affect anandamide levels in the hippocampus and prefrontal cortex (hippocampus: [F(test condition)1,16=0.32, n.s.; F(treatment) 1,16=0.001, n.s.; F(test condition × treatment) 1,16=3.53, n.s], Fig. 1e; prefrontal cortex: [F(testcondition)1,16=0.3, n.s.; F(treatment) 1,16=1.57, n.s.; F(test condition × treatment) 1,16=1.62, n.s], Fig. 1f).

Furthermore, in neither brain region investigated did social play and/or URB597 administration affect levels of 2-AG or of two other bioactive fatty acid ethanolamides that are cleaved by FAAH but do not activate cannabinoid receptors, i.e. OEA and PEA (Table 1). This is not surprising since these compounds, unlike anandamide, are good substrates for other hydrolysing enzymes in rodents (Di Marzo, 2008De Petrocellis and Di Marzo, 2009). Together, these results suggest that, during social play, anandamide levels increase in both NAc and amygdala. Furthermore, treatment with URB597 augments the social play-induced increase in anandamide levels in the amygdala, but not the NAc.

Table 1

Social play and/or URB597 administration did not affect 2-AG, OEA and PEA levels in NAc, amygdala, hippocampus and prefrontal cortex. Data represent mean ± SEM of neurotransmitter levels (pmol/g or nmol/g for 2-AG). N = 5 per treatment group.

Social play-induced changes in CB1 cannabinoid receptor phosphorylation and FAAH and NAPE-PLD expression

It has previously been shown that phosphorylated CB1 receptors, that may reflect the activation of this receptor (Garcia et al., 1998Daigle et al., 2008) are abundant in reward-related brain areas such as the NAc and the amygdala (Orio et al., 2009). To further investigate the role of endocannabinoid activity in the NAc and amygdala in the modulation of social play behavior, we measured both phosphorylated and total CB1 receptor protein expression in these brain areas in adolescent rats tested for social play behavior. The ratio between phosphorylated and total CB1 receptor protein was increased in the amygdala ([t=4.66, df=4, p<0.01], Fig. 2a), but not the NAc ([t=0.09, df=4, n.s.], Fig. 2b) in adolescent rats allowed to play compared to control animals.

Furthermore, qPCR experiments revealed no changes in the expression of NAPE-phospholipase D (NAPE-PLD), the enzyme that catalyzes the one-step conversion of N-acylphosphatidylethanolamines (NAPEs) to anandamide (Okamoto et al., 2004), in amygdala and NAc of rats allowed to interact with a play partner (amygdala: [t=−0.38, df=14, n.s.]; NAc: [t=0.16, df=14, n.s.], Table 2). Thus, the increase in anandamide levels observed in the amygdala and NAc of adolescent rats after a play session might not depend on increased anandamide synthesis. We found no changes in the expression of FAAH in either amygdala or NAc after social play (amygdala: [t=0.58, df=14, n.s.]; NAc: [t=0.2, df=14, n.s.], Table 2).

Table 2

Social play did not affect the expression of NAPE-phospholipase D (NAPE-PLD) and fatty acid amide hydrolase (FAAH) in NAc and amygdala. Data represent mean ± SEM of normalized cycles to threshold (Ct) values. N = 8 per treatment group.

Role of the amygdala and NAc in the social play-enhancing effect of URB597

To further pinpoint the role of endocannabinoid neurotransmission in the NAc and amygdala in the modulation of social play, we tested the effects of intra-NAc and intra-BLA infusion of URB597 (NAc: 0.005–0.01 μg/0.3 μl; amygdala: 0.005–0.01 μg/0.2 μl) and the CB1 cannabinoid receptor antagonist/inverse agonist SR141716A (NAc: 0.3–1–3 μg/0.3 μl; BLA: 0.03–0.1–0.3–1–3 μg/0.2 μl) on social play behavior in adolescent rats. URB597, infused into the NAc at the dose of 0.01 μg, increased pinning ([F2,23=3.9, p<0.05], Fig. 3a) and pouncing ([F2,23=4.66, p<0.05], Fig. 3b), with no effect on social exploration ([F2,23=2.27, n.s.], Table 3). We next determined whether the endocannabinoid-mediated increase in social play critically depended on activation of cannabinoid receptors in the NAc. To this aim, we tested whether blockade of NAc cannabinoid receptors by SR141716A antagonized the play-enhancing effects of systemic URB597 administration. We found that SR141716A, infused in the NAc at a dose (1 μg/0.3 μl) that did not affect social play by itself, did not antagonize the effects of systemic URB597 treatment (0.1 mg/kg, i.p.) on social play (pinning: [F(SR)1,50=0.14, n.s; F(URB)1,50=17.61, p<0.0001; F(SR × URB)1,50=0.003, n.s.], Fig. 3c; pouncing: [F(SR)1,50=0.002, n.s; F(URB)1,50=31.26, p<0.0001; F(SR × URB)1,50=0.23, n.s.], Fig. 3d). Post-hoc analysis showed that URB597 increased social play both in rats that received intra-NAc vehicle and in animals that received intra-NAc SR141716A.

Table 3

Intra-NAc and intra-amygdala infusion of URB597 (URB; 0.005–0.01 μg/0.3 μl in the NAc and 0.005–0.01 μg/0.2 μl in the amygdala) had no effect on social exploration. Data represent mean ± SEM time 

The NAc can be divided into two main subregions, i.e core and shell, that differ in their connectivity and function (Cardinal et al., 2002Kelley, 2004Voorn et al., 2004). In the previous experiments, it was not possible to differentiate between these two subregions, because cannula placements were located at the border between the core and the shell. To investigate the relative contributions of the different subregions of the NAc in the modulation of social play behavior under physiological conditions, we implanted groups of rats with bilateral guide cannulas targeted at the border between the core and the shell, at the NAc core or at the NAc shell, and infused the cannabinoid receptor antagonist/inverse agonist SR141716A (0.3–1–3 μg/0.3 μl) into each of these NAc subregions. The drug did not affect pinning and pouncing when infused at the border between the core and the shell subregions of the NAc (pinning: [F3,24=0.13, n.s.], Fig. 4a; pouncing: [F3,24=0.93, n.s.], Fig. 4b). Furthermore, SR141716A did not affect social play behavior when infused either into the core (pinning: [F3,37=0.24, n.s.], Fig. 4c; pouncing: [F3,37=0.23, n.s.], Fig. 4d) or into the shell (pinning: [F3,29=1.61, n.s.], Fig. 4e; pouncing: [F3,29=0.98, n.s.], Fig. 4f). SR141716A, infused in any NAc subregion, did not alter social exploration (data not shown). Collectively, these results indicate that increased anandamide levels within the NAc facilitate social play, but that endocannabinoid signalling in the NAc is not essential for the proper expression of social play. Therefore, endocannabinoids likely also act outside the NAc to modulate this behavior.

Concerning the role of the amygdala in the modulation of social play, we implanted rats with bilateral guide cannulas aimed at the BLA, where CB1 cannabinoid receptors are highly abundant (Tsou et al., 1998Katona et al., 2001). We found that URB597, infused into the BLA at the dose of 0.01 μg/0.2 μl, increased pinning ([F2,19=3.609, p<0.05], Fig. 5a) and pouncing ([F2,19=4.56, p<0.05], Fig. 5b), with no effect on social exploration ([F2,19d=0.48, n.s.], Table 3). Importantly, intra-BLA infusion of SR141716A (0.1 μg/0.2 μl) antagonized the effects of systemic URB597 treatment (0.1 mg/kg, i.p.) on social play (pinning: [F(SR)1,44=9.11, p<0.01; F(URB)1,44=4.31, p<0.05; F(SR × URB)1,44=5.97, p<0.05], Fig. 5c; pouncing: [F(SR)1,44=11.54, p<0.01; F(URB)1,44=11.68, p<0.01; F(SR × URB)1,44=13.60, p<0.001],Fig. 5d). Post-hoc analysis showed that URB597 increased social play in rats that received intra-BLA vehicle but not in animals that received intra-BLA SR141716A. These results show that anandamide-mediated stimulation of cannabinoid receptors within the BLA is necessary and sufficient for URB597 to increase social play behavior. Furthermore, we found that intra-BLA infusion of SR141716A at doses of 0.3–3 μg reduced both pinning ([F5,48=5.28, p<0.001], Fig. 5e) and pouncing ([F5,48=12.63, p<0.001],Fig. 5f), without affecting social exploration ([F5,48=2.21, n.s.], data not shown). This indicates that endocannabinoid activity in the BLA critically modulates social play.

For histological assessment of representative experiments see Figure 6.

Figure 6

Diagrams of rat brain sections showing representative microinjection sites (filled circles) at the border between core and shell subregions of the NAc (a); NAc core (b); NAc shell (c); BLA (d). Only data from test pairs in which both animals had bilateral 

DISCUSSION

Endocannabinoids in the limbic forebrain are known to regulate affective states and to modulate the rewarding properties of food and drugs (van der Stelt and Di Marzo, 2003Gardner, 2005Caillé et al., 2007Mahler et al., 2007Soria-Gomez et al., 2007Di Marzo et al., 2009Orio et al., 2009Shinohara et al., 2009Berridge et al., 2010Fattore et al., 2010Spano et al., 2010; McLaughlin and Gobbi, 2011). Consistent with this notion, our findings provide new evidence that endocannabinoid signalling in the limbic forebrain mediates rewarding social interactions in adolescent rats.

Our previous studies using systemic drug injections have shown that drugs that prolong ongoing endocannabinoid activity by inhibiting endocannabinoid deactivation enhance social play, suggesting that during social play, endocannabinoids are released in brain areas that mediate this behavior (Trezza and Vanderschuren, 2008ab2009). Given the role of endocannabinoid activity in the NAc and amygdala in emotion and motivation (van der Stelt and Di Marzo, 2003Gardner, 2005Laviolette and Grace, 2006Mahler et al., 2007Orio et al., 2009Shinohara et al., 2009Berridge et al., 2010Hill et al., 2010; McLaughlin and Gobbi, 2011), we hypothesized that these regions were also involved in endocannabinoid modulation of social play. To test this hypothesis, we measured endocannabinoid levels in NAc, amygdala as well as hippocampus and prefrontal cortex after social play. Vehicle-treated adolescent rats allowed to play showed higher anandamide levels in the NAc and amygdala compared to vehicle-treated animals placed alone in the test cage. This suggests that, during social play, anandamide signalling is increased in these areas. Interestingly, systemic administration of the anandamide hydrolysis inhibitor URB597 further increased the social play-induced elevation in anandamide levels in the amygdala, suggesting that URB597-enhanced anandamide signalling in the amygdala mediates its stimulatory effect on social play. Anandamide levels were unaffected in the hippocampus and prefrontal cortex. The increase in anandamide levels observed in the amygdala and NAc of adolescent rats after social play could depend on increased anandamide synthesis, or reduced anandamide hydrolysis. We found no changes in the expression of NAPE-PLD and FAAH in amygdala and NAc after social play. Therefore, the higher anandamide levels observed in the amygdala and NAc after social play might be the result of changes in: 1) expression of other anandamide biosynthetic enzymes (Di Marzo, 2008); 2) protein levels and/or activities of NAPE-PLD and FAAH; or 3) levels of anandamide biosynthetic precursor, N-arachidonoyl-phosphatidylethanolamine. Identification of the molecular mechanisms underlying the social play-associated changes in brain anandamide levels was beyond the scope of this study, and should be the subject of future investigations.

URB597 selectively inhibits FAAH activity, being 7500 to 25000 times more selective for FAAH than any other cannabinoid-related target, including endocannabinoid transport proteins and monoacylglycerol lipase (MGL), the enzyme that degrades the endocannabinoid 2-AG (Kathuria et al., 2003). Besides anandamide, FAAH also cleaves other bioactive fatty acid ethanolamides such as OEA and PEA. However, social play and/or URB597 administration did not affect 2-AG, PEA and OEA levels in any brain region investigated. Together, these results suggest that URB597 increases social play by selectively increasing anandamide signalling in the amygdala. In support of this notion, we found that social play enhanced levels of phosphorylated CB1 receptor in the amygdala, but not in the NAc of adolescent rats. Although the role of CB1 receptor phosphorylation in endocannabinoid signalling has not been studied extensively, it has been suggested that phosphorylation of the distal carboxy terminus of the CB1 receptor promotes internalization of agonist-activated full-length receptors (Daigle et al., 2008). Thus, increased CB1 receptor phosphorylation may reflect a compensatory response to reduce CB1 receptor-mediated signalling after endocannabinoid system activation (Garcia et al., 1998). Interestingly, high levels of phosphorylated CB1 receptor protein were also observed in the NAc and the amygdala of rats given extended access to cocaine (Orio et al., 2009), showing that both natural and drug rewards can induce upregulation of CB1 receptor signalling in brain areas implicated in emotion and motivation.

To further investigate the relative role of NAc and amygdala in endocannabinoid modulation of social play, we performed behavioral experiments where we tested the effects of intra-NAc and intra-amygdala infusion of URB597 or the CB1 cannabinoid receptor antagonist/inverse agonist SR141716A. We also determined whether blockade of CB1 cannabinoid receptors in the NAc or amygdala with SR141716A antagonized the increase in social play induced by systemic URB597 administration. Infusion of URB597 into the NAc enhanced social play but not social exploratory behavior, indicating that cannabinoid neurotransmission in the NAc modulates playful aspects of social interaction in adolescent rats, rather than social behavior in general. However, intra-NAc infusion of SR141716A, at a dose that reduced social play when infused into the BLA (see below), did not affect social play, or antagonize the play-enhancing effects of systemic URB597 administration. The NAc can be divided into two subregions, i.e., core and shell, that differ in terms of connectivity and function (Cardinal et al., 2002Ikemoto, 2007Kelley, 2004Voorn et al., 2004). Of these two subregions, especially the shell is thought to be involved in positive emotions (Kelley, 2004Ikemoto, 2007Berridge et al., 2010), although both core and shell have previously been implicated in opioid modulation of social play (Trezza et al., 2011a). To exclude the possibility that the involvement of endocannabinoids in the modulation of social play was underestimated when microinfusions were aimed at the core/shell border, we infused SR141716A selectively into either the core or shell. However, SR14716A did not affect social play in either region. It is known that endocannabinoid activity in the NAc increases the rewarding properties of food and drugs (Gardner, 2005Caille et al., 2007Mahler et al., 2007Soria-Gomez et al., 2007Di Marzo et al., 2009;Orio et al., 2009Shinohara et al., 2009Berridge et al., 2010). Our present results of increased social play after intra-NAc infusion of URB597 extend these findings, suggesting that endocannabinoids in the NAc also modulate social play reward. However, our finding that infusion of SR141716A into the NAc did neither affect social play, nor antagonize the play-enhancing effects of systemic treatment with URB597 indicates that other regions are critical for endocannabinoid modulation of social play.

The amygdala is essential for the attribution of emotional value to salient cues and events (Baxter and Murray, 2002Cardinal et al., 2002Balleine and Killcross, 2006). Within the amygdala, CB1 cannabinoid receptors are highly abundant in the BLA, whereas their expression and functional relevance in the central amygdala (CeA) is less clear (Tsou et al., 1998Katona et al., 2001Cota et al., 2007). Endocannabinoids in the BLA play a prominent role in the encoding of emotionally salient stimuli, but this has so far only been shown for negatively valenced stimuli. Thus, endocannabinoids in the BLA modulate acquisition, consolidation and extinction of fear memories and regulate anxiety as well as stress responses (Marsicano et al., 2002Laviolette and Grace, 2006Campolongo et al., 2009;Hill et al., 2010Karst et al., 2010; McLaughlin and Gobbi, 2011). Although in our biochemical experiments it was not possible to differentiate between the BLA and CeA, our observations of increased anandamide levels and phosphorylated CB1 receptor protein after social play indicate enhanced amygdala endocannabinoid signalling in adolescent rats during a playful social interaction. In our behavioral experiments, cannula placements were specifically aimed at the BLA. These experiments confirmed that the BLA plays a critical role in endocannabinoid modulation of social play. Intra-BLA infusion of URB597 increased, and intra-BLA infusion of SR141716A reduced social play, without affecting social exploratory behaviour. This suggests that endocannabinoid activity in the BLA critically modulates social play. Importantly, intra-BLA infusion of SR141716A antagonized the effects of systemic URB597 treatment on social play, demonstrating that stimulation of CB1 cannabinoid receptors in the amygdala is necessary and sufficient for anandamide to facilitate social play behavior. Together, our findings extend the knowledge about the physiological function of endocannabinoid signalling in the amygdala, by demonstrating that stimulation of cannabinoid receptors in the BLA modulates rewarding social interactions in adolescent rats. Thus, BLA endocannabinoids are not exclusively involved in the processing of negative emotions. Given the role of the amygdala in the assignment of emotional value to behaviourally meaningful stimuli (Baxter and Murray, 2002Cardinal et al., 2002Balleine and Killcross, 2006), our findings suggest that anandamide signalling within the BLA enhances the rewarding properties of confrontation with a playful conspecific, or of the playful social interaction itself.

Our results are consistent with human studies that have demonstrated a role of endocannabinoids in social behavior. Thus, variations in the CB1 cannabinoid receptor gene have been shown to modulate social reward responsivity in reward-related forebrain areas (Chakrabarti et al., 2006Chakrabarti and Baron-Cohen, 2011). In addition, the endocannabinoid system modulates amygdala reactivity to social threat signals (Phan et al., 2008). In view of the role of the endocannabinoid system in positive social interactions, altered function of this system may be involved in neuropsychiatric diseases characterized by aberrant socioemotional responses.

Acknowledgments

Supported by National Institute on Drug Abuse Grants R01 DA022628 (L.J.M.J.V.) and DA-009789 (V.D.M.), Netherlands Organization for Scientific Research (NWO) Veni grant 91611052 (V.T.) and Marie Curie Career Reintegration Grant PCIG09-GA-2011-293589 (V.T.). This research was performed within the framework of project T5-107 of the Dutch Top Institute Pharma.

Abbreviations

2-AG
2-arachidonoylglycerol
BLA
basolateral amygdala
NAc
nucleus accumbens
OEA
oleoylethanolamide
PEA
palmitoylethanolamide

References

  • Balleine BW, Killcross S. Parallel incentive processing: an integrated view of amygdala function.Trends Neurosci. 2006;29:272–279. [PubMed]
  • Barbano MF, Cador M. Opioids for hedonic experience and dopamine to get ready for it.Psychopharmacology (Berl) 2007;191:497–506. [PubMed]
  • Baxter MG, Murray EA. The amygdala and reward. Nat Rev Neurosci. 2002;3:563–573.[PubMed]
  • Berridge KC, Robinson TE. What is the role of dopamine in reward: hedonic impact, reward learning, or incentive salience? Brain Res Brain Res Rev. 1998;28:309–69. [PubMed]
  • Berridge KC, Ho C-Y, Richard JM, DiFeliceantonio AG. The tempted brain eats: pleasure and desire circuits in obesity and eating disorders. Brain Res. 2010;1350:43–64. [PMC free article][PubMed]
  • Caillé S, Alvarez-Jaimes L, Polis I, Stouffer DG, Parsons LH. Specific alterations of extracellular endocannabinoid levels in the nucleus accumbens by ethanol, heroin, and cocaine self-administration. J Neurosci. 2007;27:3695–3702. [PubMed]
  • Calcagnetti DJ, Schechter MD. Place conditioning reveals the rewarding aspect of social interaction in juvenile rats. Physiol Behav. 1992;51:667–672. [PubMed]
  • Campolongo P, Roozendaal B, Trezza V, Hauer D, Schelling G, McGaugh JL, Cuomo V. Endocannabinoids in the rat basolateral amygdala enhance memory consolidation and enable glucocorticoid modulation of memory. Proc Natl Acad Sci U S A. 2009;106:4888–4893.[PMC free article] [PubMed]
  • Cardinal RN, Parkinson JA, Hall J, Everitt BJ. Emotion and motivation: the role of the amygdala, ventral striatum, and prefrontal cortex. Neurosci Biobehav Rev. 2002;26:321–352.[PubMed]
  • Chakrabarti B, Baron-Cohen S. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces. Mol Autism. 2011;2:10. [PMC free article] [PubMed]
  • Chakrabarti B, Kent L, Suckling J, Bullmore E, Baron-Cohen S. Variations in the human cannabinoid receptor (CNR1) gene modulate striatal responses to happy faces. Eur J Neurosci.2006;23:1944–1948. [PubMed]
  • Cota D, Steiner MA, Marsicano G, Cervino C, Herman JP, Grubler Y, Stalla J, Pasquali R, Lutz B, Stalla GK, Pagotto U. Requirement of cannabinoid receptor type 1 for the basal modulation of hypothalamic-pituitary-adrenal axis function. Endocrinology. 2007;148:1574–1581. [PubMed]
  • Daigle TL, Kwok ML, Mackie K. Regulation of CB1 cannabinoid receptor internalization by a promiscuous phosphorylation-dependent mechanism. J Neurochem. 2008;106:70–82.[PMC free article] [PubMed]
  • De Petrocellis L, Di Marzo V. An introduction to the endocannabinoid system: from the early to the latest concepts. Best Pract Res Clin Endocrinol Metab. 2009;23:1–15. [PubMed]
  • Di Marzo V. A brief history of cannabinoid and endocannabinoid pharmacology as inspired by the work of British scientists. Trends Pharmacol Sci. 2006;27:134–140. [PubMed]
  • Di Marzo V. Targeting the endocannabinoid system: to enhance or reduce? Nat Rev Drug Discov. 2008;7:438–455. [PubMed]
  • Di Marzo V, Ligresti A, Cristino L. The endocannabinoid system as a link between homoeostatic and hedonic pathways involved in energy balance regulation. Int J Obes (Lond) 2009;33(Suppl 2):S18–24. [PubMed]
  • Douglas LA, Varlinskaya EI, Spear LP. Rewarding properties of social interactions in adolescent and adult male and female rats: impact of social versus isolate housing of subjects and partners.Dev Psychobiol. 2004;45:153–162. [PubMed]
  • Falk JL. The grooming behavior of the chimpanzee as a reinforcer. J Exp Anal Behav.1958;1:83–85. [PMC free article] [PubMed]
  • Fattore L, Melis M, Fadda P, Pistis M, Fratta W. The endocannabinoid system and nondrug rewarding behaviours. Exp Neurol. 2010;224:23–36. [PubMed]
  • Freund TF, Katona I, Piomelli D. Role of endogenous cannabinoids in synaptic signaling.Physiol Rev. 2003;83:1017–1066. [PubMed]
  • Garcia DE, Brown S, Hille B, Mackie K. Protein kinase C disrupts cannabinoid actions by phosphorylation of the CB1 cannabinoid receptor. J Neurosci. 1998;18:2834–2841. [PubMed]
  • Gardner EL. Endocannabinoid signaling system and brain reward: emphasis on dopamine.Pharmacol Biochem Behav. 2005;81:263–284. [PubMed]
  • Guidali C, Vigano D, Petrosino S, Zamberletti E, Realini N, Binelli G, Rubino T, Di Marzo V, Parolaro D. Cannabinoid CB1 receptor antagonism prevents neurochemical and behavioural deficits induced by chronic phencyclidine. Int J Neuropsychopharmacol. 2011;14:17–28.[PubMed]
  • Hill MN, McLaughlin RJ, Bingham B, Shrestha L, Lee TT, Gray JM, Hillard CJ, Gorzalka BB, Viau V. Endogenous cannabinoid signaling is essential for stress adaptation. Proc Natl Acad Sci U S A. 2010;107:9406–9411. [PMC free article] [PubMed]
  • Humphreys AP, Einon DF. Play as a reinforcer for maze-learning in juvenile rats. Anim Behav.1981;29:259–270.
  • Ikemoto S, Panksepp J. The effects of early social isolation on the motivation for social play in juvenile rats. Dev Psychobiol. 1992;25:261–274. [PubMed]
  • Ikemoto S. Dopamine reward circuitry: two projection systems from the ventral midbrain to the nucleus accumbens-olfactory tubercle complex. Brain Res Rev. 2007;56:27–78.[PMC free article] [PubMed]
  • Kathuria S, Gaetani S, Fegley D, Valino F, Duranti A, Tontini A, Mor M, Tarzia G, La Rana G, Calignano A, Giustino A, Tattoli M, Palmery M, Cuomo V, Piomelli D. Modulation of anxiety through blockade of anandamide hydrolysis. Nat Med. 2003;9:76–81. [PubMed]
  • Karst H, Berger S, Erdmann G, Schütz G, Joëls M. Metaplasticity of amygdalar responses to the stress hormone corticosterone. Proc Natl Acad Sci U S A. 2010;107:14449–14454.[PMC free article] [PubMed]
  • Katona I, Rancz EA, Acsady L, Ledent C, Mackie K, Hajos N, Freund TF. Distribution of CB1 cannabinoid receptors in the amygdala and their role in the control of GABAergic transmission.J Neurosci. 2001;21:9506–9518. [PubMed]
  • Kelley AE. Ventral striatal control of appetitive motivation: role in ingestive behavior and reward-related learning. Neurosci Biobehav Rev. 2004;27:765–776. [PubMed]
  • Laviolette SR, Grace AA. The roles of cannabinoid and dopamine receptor systems in neural emotional learning circuits: implications for schizophrenia and addiction. Cell Mol Life Sci.2006;63:1597–1613. [PubMed]
  • Leweke FM, Koethe D. Cannabis and psychiatric disorders: it is not only addiction. Addict Biol.2008;13:264–275. [PubMed]
  • Lutz B. Endocannabinoid signals in the control of emotion. Curr Opin Pharmacol. 2009;9:46–52. [PubMed]
  • Mahler SV, Smith KS, Berridge KC. Endocannabinoid hedonic hotspot for sensory pleasure: anandamide in nucleus accumbens shell enhances ‘liking’ of a sweet reward.Neuropsychopharmacology. 2007;32:2267–2278. [PubMed]
  • Marco EM, Garcia-Gutierrez MS, Bermudez-Silva FJ, Moreira FA, Guimaraes F, Manzanares J, Viveros MP. Endocannabinoid system and psychiatry: in search of a neurobiological basis for detrimental and potential therapeutic effects. Front Behav Neurosci. 2011;5:63.[PMC free article] [PubMed]
  • Marsicano G, Wotjak CT, Azad SC, Bisogno T, Rammes G, Cascio MG, Hermann H, Tang J, Hofmann C, Zieglgansberger W, Di Marzo V, Lutz B. The endogenous cannabinoid system controls extinction of aversive memories. Nature. 2002;418:530–534. [PubMed]
  • Mason WA, Saxon SV, Sharpe LG. Preferential responses of young chimpanzees to food and social rewards. Psychol Rec. 1963;13:341–345.
  • McLaughlin RJ, Gobbi G. Cannabinoids and emotionality: a neuroanatomical perspective.Neuroscience. 2012;204:134–144. [PubMed]
  • Niesink RJM, Van Ree JM. Involvement of opioid and dopaminergic systems in isolation-induced pinning and social grooming of young rats. Neuropharmacology. 1989;28:411–418.[PubMed]
  • Normansell L, Panksepp J. Effects of morphine and naloxone on play-rewarded spatial discrimination in juvenile rats. Dev Psychobiol. 1990;23:75–83. [PubMed]
  • Okamoto Y, Morishita J, Tsuboi K, Tonai T, Ueda N. Molecular characterization of a phospholipase D generating anandamide and its congeners. J Biol Chem. 2004;279:5298–5305. [PubMed]
  • Orio L, Edwards S, George O, Parsons LH, Koob GF. A role for the endocannabinoid system in the increased motivation for cocaine in extended-access conditions. J Neurosci. 2009;29:4846–4857. [PMC free article] [PubMed]
  • Pacher P, Batkai S, Kunos G. The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacol Rev. 2006;58:389–462. [PMC free article] [PubMed]
  • Panksepp J, Siviy SM, Normansell L. The psychobiology of play: theoretical and methodological perspectives. Neurosci Biobehav Rev. 1984;8:465–492. [PubMed]
  • Paxinos G, Watson C. The rat brain in stereotaxic coordinates. 6. San Diego: Elsevier Academic Press; 2007.
  • Peciña S, Berridge KC. Hedonic hot spot in nucleus accumbens shell: where do μ-opioids cause increased hedonic impact of sweetness? J Neurosci. 2005;25:11777–11786. [PubMed]
  • Pellis SM, Pellis V. The playful brain: venturing to the limits of neuroscience. Oxford, UK: Oneworld Publications; 2009.
  • Phan KL, Angstadt M, Golden J, Onyewuenyi I, Popovska A, de Wit H. Cannabinoid modulation of amygdala reactivity to social signals of threat in humans. J Neurosci.2008;28:2313–2319. [PMC free article] [PubMed]
  • Piomelli D. The molecular logic of endocannabinoid signalling. Nat Rev Neurosci. 2003;4:873–884. [PubMed]
  • Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers.Methods Mol Biol. 2000;132:365–386. [PubMed]
  • Salamone JD, Correa M, Mingote SM, Weber SM. Beyond the reward hypothesis: alternative functions of nucleus accumbens dopamine. Curr Opin Pharmacol. 2005;5:34–41. [PubMed]
  • Shinohara Y, Inui T, Yamamoto T, Shimura T. Cannabinoid in the nucleus accumbens enhances the intake of palatable solution. Neuroreport. 2009;20:1382–1385. [PubMed]
  • Simmons D, Self DW. Role of mu- and delta-opioid receptors in the nucleus accumbens in cocaine-seeking behavior. Neuropsychopharmacology. 2009;34:1946–1957. [PMC free article][PubMed]
  • Siviy SM, Panksepp J. In search of the neurobiological substrates for social playfulness in mammalian brains. Neurosci Biobehav Rev. 2011;35:1821–1830. [PubMed]
  • Solinas M, Goldberg SR, Piomelli D. The endocannabinoid system in brain reward processes. Br J Pharmacol. 2008;154:369–383. [PMC free article] [PubMed]
  • Soria-Gomez E, Matias I, Rueda-Orozco PE, Cisneros M, Petrosino S, Navarro L, Di Marzo V, Prospero-Garcia O. Pharmacological enhancement of the endocannabinoid system in the nucleus accumbens shell stimulates food intake and increases c-Fos expression in the hypothalamus. Br J Pharmacol. 2007;151:1109–1116. [PMC free article] [PubMed]
  • Spano MS, Fadda P, Fratta W, Fattore L. Cannabinoid-opioid interactions in drug discrimination and self-administration: effect of maternal, postnatal, adolescent and adult exposure to the drugs. Curr Drug Targets. 2010;11:450–461. [PubMed]
  • Thiel KJ, Okun AC, Neisewander JL. Social reward-conditioned place preference: A model revealing an interaction between cocaine and social context rewards in rats. Drug Alcohol Depend. 2008;96:202–212. [PMC free article] [PubMed]
  • Thiel KJ, Sanabria F, Neisewander JL. Synergistic interaction between nicotine and social rewards in adolescent male rats. Psychopharmacology (Berl) 2009;204:391–402.[PMC free article] [PubMed]
  • Trezza V, Vanderschuren LJMJ. Bidirectional cannabinoid modulation of social behavior in adolescent rats. Psychopharmacology (Berl) 2008a;197:217–227. [PubMed]
  • Trezza V, Vanderschuren LJMJ. Cannabinoid and opioid modulation of social play behavior in adolescent rats: differential behavioral mechanisms. Eur Neuropsychopharmacol.2008b;18:519–530. [PMC free article] [PubMed]
  • Trezza V, Vanderschuren LJMJ. Divergent effects of anandamide transporter inhibitors with different target selectivity on social play behavior in adolescent rats. J Pharmacol Exp Ther.2009;328:343–350. [PMC free article] [PubMed]
  • Trezza V, Damsteegt R, Vanderschuren LJMJ. Conditioned place preference induced by social play behavior: parametrics, extinction, reinstatement and disruption by methylphenidate. Eur Neuropsychopharmacol. 2009;19:659–669. [PMC free article] [PubMed]
  • Trezza V, Baarendse PJJ, Vanderschuren LJMJ. The pleasures of play: pharmacological insights into social reward mechanisms. Trends Pharmacol Sci. 2010;31:463–469.[PMC free article] [PubMed]
  • Trezza V, Damsteegt R, Achterberg EJM, Vanderschuren LJMJ. Nucleus accumbens μ-opioid receptors mediate social reward. J Neurosci. 2011a;31:6362–6370. [PMC free article] [PubMed]
  • Trezza V, Campolongo P, Vanderschuren LJMJ. Evaluating the rewarding nature of social interactions in laboratory animals. Dev Cogn Neurosci. 2011b;1:444–458. [PubMed]
  • Tsou K, Brown S, Sanudo-Pena MC, Mackie K, Walker JM. Immunohistochemical distribution of cannabinoid CB1 receptors in the rat central nervous system. Neuroscience. 1998;83:393–411.[PubMed]
  • van der Stelt M, Di Marzo V. The endocannabinoid system in the basal ganglia and in the mesolimbic reward system: implications for neurological and psychiatric disorders. Eur J Pharmacol. 2003;480:133–150. [PubMed]
  • Vanderschuren LJMJ, Niesink RJM, Spruijt BM, Van Ree JM. Effects of morphine on different aspects of social play in juvenile rats. Psychopharmacology. 1995;117:225–231. [PubMed]
  • Vanderschuren LJMJ, Niesink RJM, Van Ree JM. The neurobiology of social play behavior in rats. Neurosci Biobehav Rev. 1997;21:309–326. [PubMed]
  • Vanderschuren LJMJ, Trezza V, Griffioen-Roose S, Schiepers OJG, Van Leeuwen N, De Vries TJ, Schoffelmeer ANM. Methylphenidate disrupts social play behavior in adolescent rats.Neuropsychopharmacology. 2008;33:2946–2956. [PMC free article] [PubMed]
  • Viveros MP, Marco EM, Llorente R, Lopez-Gallardo M. Endocannabinoid system and synaptic plasticity: implications for emotional responses. Neural Plast. 2007;2007:52908.[PMC free article] [PubMed]
  • Voorn P, Vanderschuren LJMJ, Groenewegen HJ, Robbins TW, Pennartz CM. Putting a spin on the dorsal-ventral divide of the striatum. Trends Neurosci. 2004;27:468–474. [PubMed]
  • Wotjak CT. Role of endogenous cannabinoids in cognition and emotionality. Mini Rev Med Chem. 2005;5:659–670. [PubMed]
  • Zanettini C, Panlilio LV, Alicki M, Goldberg SR, Haller J, Yasar S. Effects of endocannabinoid system modulation on cognitive and emotional behavior. Front Behav Neurosci. 2011;5:57.[PMC free article] [PubMed]
  • Zhou Y, Adolfs Y, Pijnappel WW, Fuller SJ, Van der Schors RC, Li KW, Sugden PH, Smit AB, Hergovich A, Pasterkamp RJ. MICAL-1 is a negative regulator of MST-NDR kinase signaling and apoptosis. Mol Cell Biol. 2011;31:3603–3615. [PMC free article] [PubMed]
 potp font 1