Skip to main content
Canna~Fangled Abstracts

Cannabinoids Inhibit T-cells via Cannabinoid Receptor 2 in an In Vitro Assay for Graft Rejection, the Mixed Lymphocyte Reaction.

By July 4, 2013No Comments
pub med big
[Epub ahead of print]
Logo of nihpa

J Neuroimmune Pharmacol. Author manuscript; available in PMC Dec 1, 2014.
Published in final edited form as:
PMCID: PMC3864984
NIHMSID: NIHMS502220

Abstract

pm2Cannabinoids are known to have anti-inflammatory and immunomodulatory properties. Cannabinoid receptor 2 (CB2) is expressed mainly on leukocytes and is the receptor implicated in mediating many of the effects of cannabinoids on immune processes. This study tested the capacity of Δ9-tetrahydrocannabinol (Δ9-THC) and of two CB2-selective agonists to inhibit the murine Mixed Lymphocyte Reaction (MLR), an in vitro correlate of graft rejection following skin and organ transplantation. Both CB2-selective agonists and Δ9-THC significantly suppressed the MLR in a dose dependent fashion. The inhibition was via CB2, as suppression could be blocked by pretreatment with a CB2-selective antagonist, but not by a CB1 antagonist, and none of the compounds suppressed the MLR when splenocytes from CB2 deficient mice were used. The CB2 agonists were shown to act directly on T-cells, as exposure of CD3+ cells to these compounds completely inhibited their action in a reconstituted MLR. Further, the CB2-selective agonists completely inhibited proliferation of purified T-cells activated by anti-CD3 and anti-CD28 antibodies. T-cell function was decreased by the CB2 agonists, as an ELISA of MLR culture supernatants revealed IL-2 release was significantly decreased in the cannabinoid treated cells. Together, these data support the potential of this class of compounds as useful therapies to prolong graft survival in transplant patients.

Keywords: Cannabinoids, Cannabinoid Receptor 2, Mixed Lymphocyte Reaction, T-cells, Immunosuppression

Introduction

Cannabinoids were reported to have effects on immune responses as early as the 1970s (Gupta et al. 1974Johnson and Wiersema 1974Nahas et al. 1974Neu et al. 1970), but the basis for this activity was not understood until the cannabinoid receptors were cloned. To date, two cannabinoid receptors have been identified, designated CB1 and CB2. The CB1 receptor was found at the highest levels on neurons in the central nervous system (Galiegue et al. 1995Herkenham et al. 1991Matsuda et al. 1990) and to a lesser extent on cells of the immune system and testes (Daaka et al. 1996Galiegue et al. 1995Waksman et al. 1999). However, the CB2 receptor was found to be expressed primarily on cells of the immune system, including B-cells, natural killer cells (NK cells), monocytes, polymorphonuclear cells, T-cells, and activated microglia (Galiegue et al. 1995Munro et al. 1993Murikinati et al. 2010). Discovery that these receptors were expressed on leukocytes provided a rationale for the functional effects of Δ9-THC on the immune system, which have been reported to suppress nearly every type of immune cell. There are numerous reports on the suppression of macrophages by Δ9-THC, primarily by decreasing their antigen-presenting abilities. Macrophages exposed to Δ9-THC resulted in the inhibition of phagocytosis, antigen processing of certain proteins, capacity for co-stimulation, nitric oxide production, pro-inflammatory cytokine release and production in macrophages and microglia (reviewed by Klein et al. 2006), as well as the migration of activated microglia (Fraga et al. 2011). Treatment with Δ9-THC was found to suppress lymphocyte recruitment, proliferation, and function following inflammatory stimuli and to modulate cytokine and antibody levels and types (reviewed by Roth 2002 and Croxford and Yamamura 2005). In addition, Δ9-THC was found to induce a shift from T helper 1 (Th1) to T helper 2 (Th2) cells following Legionella pneumophila infection (reviewed by Klein et al. 2003).

In much of the preceding literature on Δ9-THC, it was not determined whether the cannabinoid was altering immune function through the CB1 or the CB2 receptor, although a few studies have shown effects to be exclusively through CB2 (Eisenstein, 2007McCoy et al. 1999Yuan et al. 2002). Until recently, this question could only be approached using selective antagonists for the two receptors. The development of synthetic cannabinoids that are selective for CB2 (Huffman et al. 1996Huffman et al. 1999Huffman et al. 2005Marriott et al. 2006) has allowed direct testing of the hypothesis that agonist activation of this receptor down-regulates immune responses. CB2-selective agonists have been shown to be anti-inflammatory and immunosuppressive in mouse models of a wide variety of conditions where immune responses are detrimental, including Experimental Autoimmune Encephalitis (EAE), which is a mouse model of multiple sclerosis (Maresz et al. 2007Zhang et al. 2009b), ischemic/perfusion injury following an induced stroke (Ni et al. 2004Zhang et al. 2007Zhang et al. 2009a), rheumatoid arthritis (Sumariwalla et al. 2004), inflammatory bowel disease (Storr et al. 2009), spinal cord injury (Adhikary et al. 2011Baty et al. 2008), sepsis (Tschöp et al. 2009), autoimmune uveoretinitis (Xu et al. 2007), osteoporosis (Ofek et al. 2006) and systemic sclerosis (Servettaz et al. 2010a).

Organ transplantation and skin grafts are conditions in which activated immune responses greatly hinder the success of the transplant. Specifically, alloreactive T-cells, which recognize histoincompatible antigens on transplanted tissue, mediate tissue and organ rejection (reviewed by Heeger 2003). Δ9-THC, given in vivo to mice, has been reported to inhibit ex vivo reactivity of spleen cells from treated animals when exposed to histoincompatible spleen cells in vitro in the Mixed Lymphocyte Reaction (MLR), an in vitro correlate of graft rejection (Zhu et al. 2000). Whether the effect was via CB1 or CB2 receptors was not explored. As CB2-selective cannabinoids have been shown to inhibit T-cells in several experimental conditions, as evidenced by decreasing production of the cytokines IL-2, IL-6, IFN-γ, and TNF-α, inhibiting migration of T-cells to inflammatory stimuli, and inhibiting proliferation of T-cells (Borner et al. 2009Cencioni et al. 2010Maresz et al. 2007Xu et al. 2007Ghosh et al. 2006Coopman et al. 2007), it was hypothesized that CB2-selective agonists would block graft rejection.

The current study explored the potential of Δ9-THC and two CB2-selective agonists, JWH-015 and O-1966, for their capacity to inhibit the MLR in vitro, which is a correlate of in vivo graft rejection. It was found that these cannabinoids directly suppressed T-cells in a dose-dependent manner, through activation of the CB2 receptor. The results suggest that CB2-selective cannabinoids are a candidate class of compounds as novel therapeutic agents to prevent graft rejection following transplantation.

Materials and Methods

Mice

Six week-old, specific pathogen-free C3HeB/FeJ and C57BL/6J female mice were purchased from Jackson Laboratories (Bar Harbor, Maine). Founder CB2 receptor deficient (CB2R k/o) mice, on a C57BL/6J background were obtained from the National Institutes of Health (Bethesda, MD) and bred in the Animal Core of the Center for Substance Abuse Research, P30 Center for Excellence, at Temple University School of Medicine Central Animal Facility.

Compounds

Δ9-tetrahydrocannabinol (Δ9-THC) was provided by The National Institute on Drug Abuse (NIDA, Rockville, MD). Δ9-THC was supplied as a solution of 50 mg/ml in absolute ethanol and stored at 4°C. JWH-015 (CB2-selective agonist) was purchased from Tocris Biosciences (Bristol, UK). O-1966 (CB2-selective agonist) was a generous gift from Anu Mahadevan (Organix, Woburn, MA). SR141716A (CB1-selective antagonist) and SR144528 (CB2-selective antagonist) were obtained from Research Triangle Institute (Research Triangle Park, NC). Each of these compounds was supplied as crystals and stored at −20°C. Before each use, JWH-015, SR141716A, and SR144528 were dissolved in absolute ethanol and O-1966 was dissolved in DMSO. The solutions were added drop-wise to the medium used for the assay (RPMI-1640) to obtain the desired concentration.

One-way Mixed Lymphocyte Reaction (MLR)

Mice were sacrificed and their spleens aseptically removed. Single cell suspensions were obtained by passing spleens through nylon mesh bags (Sefar Inc., Depew, NY) in RPMI-1640 with 5% fetal bovine serum (FBS) containing 50 µM 2-mercaptoethanol (2-Me), and 100 U/ml penicillin and streptomycin sulfate. All reagents were purchased from Gibco Life Technologies (Carlsbad, CA), with the exception of FBS, which was purchased from HyClone Laboratories (Logan, UT). Red blood cells were lysed by hypotonic shock for 10 seconds with sterile water. Responder spleen cells from C57BL/6 mice were resuspended in RPMI with 10% FBS, 50 µM 2-Me, and 100 U/ml penicillin and streptomycin sulfate. Splenocytes from C3HeB/FeJ were similarly prepared to serve as the stimulator cells, but they were inactivated by treatment with 50 µg/ml of mitomycin C for 20 min at 37°C. The cells were washed 3 times to remove mitomycin C from the medium and resuspended to the desired concentration using a Beckman Coulter Z1 Dual Cell and Particle Counter (Beckman Coulter Inc., Indianapolis, IN). Responder cells (8 × 105) and stimulator cells (8 × 105) were co-cultured in 200 µl in 96 well plates for 48 h at 37°C in 5% CO2. In wells where it was desired, 50 µl of cannabinoid was added to 100 µl responder cells 3 h prior to mixing with 50 µl stimulator cells. If antagonists were used, 50 µl were added to 50 µl responder cells for 2 h prior to adding the agonist, followed by a 3 h incubation with 50 µl agonist, before mixing with 50 µl stimulator cells. After a 48 h incubation period, cultures were pulsed with 1 µCi/well [3H]-thymidine and harvested 18 h later onto glass fiber filters (Packard, Downers Grove, IL) using a Packard multichannel harvester, and placed in vials in liquid scintillation solution (Cytoscint, MP-Biomedical, Irvine, CA). [3H]-thymidine incorporation on the filters was measured using a Packard 1900 TR liquid scintillation counter. Data were corrected for background by subtraction of [3H]-thymidine incorporation in the absence of stimulator cells. Results are expressed as a Suppression Index (SI), where untreated spleen cells are given a value of 1.00 (100%), and responses of cultures receiving treatment with cannabinoids are calculated as:

SI=Mean counts per minute/cannabinoid treated culturesMean counts per minute/untreated cultures

Fluorescence Activated Cell Sorting (FACS)

Splenocytes were resuspended in staining buffer: PBS containing 1% BSA (Sigma, St. Louis, MO). Cells were incubated with 1 µg/106 cells of 2.4G2 antibody specific for Fcγ III/II receptor at 4°C for 5 minutes to prevent nonspecific binding. Cells were then incubated with 0.5 µg/106cells of PE-conjugated rat anti-mouse CD11b and PerCP-conjugated rat anti-mouse CD3ε (BioLegend, San Diego, CA), for 30 min on ice. Cells were then washed twice with sorting buffer: PBS containing 0.1% BSA (Sigma). Cells were resuspended in sorting buffer (PBS containing 0.1% BSA) to a concentration of 40 × 106 cells/ml, and then sorted using the FACSAria™ system (BD Biosciences, San Jose, CA). Purity of sorted cells was checked by analyzing a sample from each sorted population (CD3+ and CD11b+) on the flow cytometer at the completion of sorting. Cell purity was 99% for all experiments.

mRNA Expression Analysis

Splenocytes were harvested and either immediately sorted or cultured in the MLR for 24 h before sorting by flow cytometry into CD3+ and CD11b+ populations as described above. Total RNA was extracted using an Rneasy® Mini Kit (Qiagen, Valencia, CA) according to the provided protocol. RNA concentration and purity was checked with a NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA). 1 µg of RNA was then reverse transcribed to cDNA using the RT2 First Strand Kit (Qiagen) following the provided protocol. For quantitative PCR (qPCR), cDNA was diluted 10-fold in DEPC water and 4 µl was added to 16 µl of Power SYBR® Green PCR Master Mix (Applied Biosystems, Carlsbad, CA) containing 200 nM of forward and reverse primers specific for mouse CB2 or mouse β-Actin (Invitrogen, Grand Island, NY). The qPCR was performed using a Mastercycler ep Realplex2 (Eppendorf, Hamburg, Germany) starting with 1 cycle at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 75°C for 30 sec, 57°C for 30 sec, and a melting curve analysis. The relative quantification of CB2 was calculated based on the number of cycles required for the fluorescence emission to reach the threshold level (CT) of CB2, normalized to the CT of the reference gene β-Actin. To ensure the amplification was of CB2 message and not contaminating genomic DNA, RNA samples that were not reverse transcribed were run with each reaction. The following primers were used: CB2 Forward 5’- GTGATCTTCGCCTGCAACTTT -3’, CB2 Reverse 5’-GGAGTCGACCCCGTGGA -3’, β-Actin Forward 5’-AGCTTCTTTGCAGCTCCTTCGTTGC-3’, and β-Actin Reverse 5’-ACCAGCGCAGCGATATCGTCA-3’.

ELISA

IL-2 levels in the MLR culture supernatant were determined using the Quantikine® Mouse IL-2 Immunoassay (R&D Systems, Inc., Minneapolis, MN). 96 well microplates were obtained pre-coated with a polyclonal antibody specific for mouse IL-2. The supernatant was incubated for 2 h at room temperature, after which any unbound antigen was removed by five washes. Enzyme-linked polyclonal antibody for mouse IL-2 was added and incubated at room temperature for 2 h. Following five washes to remove unbound antibody, a stabilized hydrogen peroxide and chromogen substrate solution was added and incubated for 30 min at room temperature protected from light, followed by addition of dilute hydrochloric acid stop solution. The optical density was determined using a POLARstar Omega microplate reader (BMG LABTECH, Offenburg, Germany).

Cell Viability

Cell viability was assessed using cell cultures that were run in parallel with each experimental MLR. Viability from experiments was measured by flow cytometry using the LIVE/DEAD®Fixable Dead Cell Stain Kit from Molecular Probes, Inc. (Eugene, OR). 1×106 cells from cultures were resuspended in 1 ml FCM Staining Buffer and incubated for 30 min at room temperature with 1 µl Dead Cell Stain. Cells were washed twice and resuspended in FCM staining buffer and analyzed using LSRII (BD Biosciences) and analyzed using FACSDiva software (BD Biosciences). In addition, cell viability in several experiments was also checked with Trypan blue exclusion test. Cultures run in parallel with the experimental MLR were diluted to 1.6 × 106 cells/ml and 0.2% Trypan Blue was added. The cells were scored for viability using a hemocytometer.

Apoptosis

The presence of apoptotic cells was examined using the APO-BrdU™ TUNEL Assay Kit from Molecular Probes, Inc (Eugene, OR) and Vybrant® FAM Poly Caspases Assay Kit from Molecular Probes, Inc. For TUNEL assays, 2×106 cells per sample in MLR culture were collected 0, 24, and 48 h after stimulator cells were added. The cells were fixed with 1% (w/v) paraformaldehyde in PBS for 15 min on ice and then permeabilized by adding 3 mL ice-cold 70% ethanol in PBS. The cells were stored in this solution at −20°C until day 3 of the experiment. The TUNEL assay was then performed by following the protocol provided by the manufacturer. For caspase assays, 1×106 cells per sample in MLR culture were collected at 0, 24, and 48 h after stimulator cells were added, and the assay performed by following the protocol provided by the manufacturer.

Statistics

Data were transformed to normalized ratios, to accommodate non-normality of the data. Comparisons between groups were tested using ANOVA with vertical group comparisons at each dose. Least square means were used for horizontal and vertical comparisons between groups and doses. No adjustment was made for multiple comparisons. Statistical significance was defined as p values < 0.01 or 0.001.

Results

Cannabinoids inhibit the MLR in a dose-dependent manner via the CB2 receptor

To determine the effect of Δ9-THC, JWH-015 and O-1966 on the MLR, 8×105 C57BL/6 responder splenocytes were pretreated for 3 h with cannabinoid or vehicle before addition of 8×105 mitomycin C inactivated C3HeB/FeJ splenocytes. Figure 1 shows that pretreatment with all three cannabinoids inhibited the MLR in a dose-dependent manner, with suppression observed between 8 and 32 µM compared to vehicle controls. For the CB2-selective agonists, significant suppression was observed at 4 uM. Using a Live/Dead stain, cell viability was assessed and no difference observed in the number of dead cells between control and cannabinoid treated groups. A representative group from data collected for Figure 1, showed cells from MLR cultures that received no treatment were 88.7% live, cells that were treated with ethanol vehicle were 86.9% live, and cells treated with 32 µM Δ9-THC were 87.9% live. Similarly, cells from other cultures that were treated with 32 µM JWH-015 or O-1966 were 88.6% and 88.5% live, respectively. Viability was checked in each experiment hereafter, and cells were 85–90% live in all experiments.

Fig. 1Fig. 1Fig. 1

The cannabinoids Δ9-THC, JWH-015 and O-1966 inhibit the MLR in a dose-dependent manner. C57BL/6 responder splenocytes were pretreated for 3 h with: Panel a: Δ9-THC (▲) or ethanol vehicle (■), Panel b: JWH-015 ([diamond]

To verify whether the cannabinoids were inducing suppression of the MLR via CB1 or CB2 receptors, CB1- and CB2-selective antagonists were used. C57BL/6 responder splenocytes were pretreated for 2 h with the CB1-selective antagonist SR141716A, the CB2-selective antagonist SR144528, or ethanol vehicle. The cells were then treated for 3 h with Δ9-THC, JWH-015, O-1966, or vehicle controls, before mitomycin C inactivated C3HeB/FeJ splenocytes were added to each well. As shown in Figure 2, pretreatment with the CB2-selective antagonist significantly blocked suppression by Δ9-THC, JWH-015 and O-1966, while pretreatment with the CB1-selective antagonist had no effect on the suppression induced by any of the three cannabinoids.

Fig. 2Fig. 2Fig. 2

Δ9-THC and the CB2-selective agonists, JWH-015 and O-1966, inhibit the MLR via the CB2 receptor. C57BL/6 responder splenocytes were pretreated with varying concentrations of SR141716A, a CB1 antagonist, ([big down triangle, open]), SR144528, a CB2 antagonist 

To corroborate the pharmacological evidence that Δ9-THC, JWH-015, and O-1966 act via the CB2 receptor, splenocytes from CB2 receptor knockout (CB2R k/o) mice were treated with these compounds and tested in the MLR. As shown in Figure 3, pretreatment with Δ9-THC, JWH-015 or O-1966 inhibited the MLR when cells from wild-type mice were used, but not in cultures containing splenocytes from CB2R k/o mice. No difference in viability was observed between cultures from wild-type or CB2R k/o mice, with all treatments yielding viability between 85–90% viable cells.

Fig. 3Fig. 3Fig. 3

Δ9-THC, JWH-015, and O-1966 do not suppress the MLR when splenocytes from CB2R k/o are used. Splenocytes from CB2-deficient mice (open symbols) or wild-type mice (closed symbols) were treated for 3 h. Panel a: Δ9-THC (WT: ▲, k/o:

Together, these results support the conclusion that Δ9-THC, JWH-015, and O-1966 are suppressing the MLR via the CB2 receptor.

JWH-015 and O-1966 inhibit the release of IL-2 in the MLR

To examine the effect of cannabinoids on one aspect of T-cell function, the release of IL-2 in the MLR was examined. Culture supernatants from unfractionated spleen cells were collected 24 h after the start of the MLR incubation. Figure 4 shows both JWH-015 and O-1966 inhibited IL-2 release in a dose-dependent manner, indicating that the cannabinoids inhibit this parameter of T-cell function. Furthermore, when splenocytes from CB2R k/o mice were used, O-1966 treatment did not inhibit IL-2 release, indicating this effect is CB2 receptor dependent.

Fig. 4Fig. 4

JWH-015 and O-1966 inhibit the release of IL-2 in the MLR. To determine the effect of CB2-selective cannabinoids on the release of IL-2, CB2R k/o responder splenocytes (open symbols) or wild-type littermates (closed symbols) were pretreated for 3 h with: 

JWH-015 and O-1966 inhibit T-cells

The question was addressed as to whether the cannabinoids act directly on the T-cells, on accessory cells, or on both types of cells. Splenocytes from wild-type C57BL/6 mice were sorted into highly purified subpopulations using flow cytometry. Specifically, CD3+ (T-cells) and CD11b+ (myeloid derived cells) populations were selected and individually treated with JWH-015 or ethanol vehicle, or O-1966 or DMSO vehicle, before being added back to the remainder of the untreated spleen cells, which were either CD3 or CD11b depleted, to restore the normal spleen population. The reconstituted cells were then incubated with mitomycin C inactivated C3HeB/FeJ stimulator splenocytes. Figure 5 shows that complete inhibition of the MLR was observed only in cultures containing CD3+ cells that had been treated with a cannabinoid. In cultures that received cannabinoid treated CD11b+ cells, significant inhibition was only observed for CD11b+ cells that were treated with 32 µM JWH-015 (p<0.01), while treatment of CD11b+cells with any dose of O-1966 did not reach statistical significance. Further, CD11b+ cells treated with 8 µM, 16 µM, or 32 µM of JWH-015 or O-1966 were significantly less inhibited than unsorted cells treated with the same dose of cannabinoid, indicating that the observed effect of CB2 agonists can be attributed primarily to a direct effect on the T-cells.

Fig. 5Fig. 5

JWH-015 and O-1966 directly inhibit T-cells. C57BL/6 splenocytes were sorted by flow cytometry into CD3+, CD11b+, or CD3−CD11b− fractions. CD3+ fractions (▲) or CD11b+ fractions (■) were treated for 3 h with the desired 

To rule out the possibility that cannabinoids were inhibiting CD3+ cells to a greater extent than CD11b+ cells from disproportionate expression of CB2 receptors, quantitative PCR was performed to measure CB2 receptor (CB2R) RNA expression levels in purified CD3+ cells and CD11b+ cells immediately after spleens were removed (T0) and after 24 h in the MLR (T24). CB2R expression was not significantly different between these cell populations at T0. By T24, both populations had significantly increased CB2R expression, with a 26.6-fold increase in CD11b+ cells and a 6.9-fold in CD3+ cells (Fig. 6). Thus, the data do not support the hypothesis that the reason for the increased inhibition by CD3+ cells was due to a greater expression of CB2R.

Fig. 6

CB2 receptor (CB2R) expression increases in the MLR. C57BL/6 splenocytes were sorted by flow cytometry immediately after harvest (T0) or after 24 h in the MLR (T24). CD3+ and CD11b+ populations were collected, RNA was extracted, reverse transcribed, and 

To further verify that the cannabinoids can directly suppress T-cells, splenocytes were sorted into a CD3+ population. Purified T-cells were treated for 3 hours with O-1966 or DMSO vehicle and then activated with the anti-CD3 and anti-CD28 antibodies. In the presence of O-1966 (Fig. 7), there was a dose-dependent, marked decrease in proliferation. This experiment shows conclusively that the cannabinoids can act directly on T-cells, as proliferation could be inhibited by the cannabinoid in the absence of accessory cells.

Fig. 7

O-1966 inhibits T-cell proliferation in response to activation by anti-CD3 and anti-CD28 antibodies. Purified C57BL/6 T-cells (CD3+) were treated for 3 h with O-1966 (●) or DMSO vehicle (■). The T-cells were added to a plate coated with 

JWH-015 and O-1966 do not induce apoptosis

A possible mechanism that has been proposed for cannabinoid mediated immunosuppression is through the induction of apoptosis of activated immune cells (Lombard et al. 2007McKallip et al. 2002). While the present paper reports membrane integrity of the cells in the experiments was unchanged by cannabinoid treatment, as measured by LIVE/DEAD staining in each experimental condition, more precise measurements were used to detect and measure apoptotic cells. To detect cells in the early stages of apoptosis, MLR cultures treated with JWH-015, O-1966, or vehicle were harvested at the start of the culture, and 24 and 48 h into the assay. Levels of caspases 1, 3, 4, 5, 7, 8, and 9 were measured by flow cytometry using a caspase assay kit (Vybrant® FAM Poly Caspases Assay Kit, Molecular Probes, Inc., Eugene, OR). Figure 8ashows that, while the number of caspase positive cells increased as time in culture increased, there were no differences between cells that received no treatment or treatment with vehicle, as compared with treatment with a cannabinoid. Additionally, DNA fragmentation was measured using a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay (Fig. 8b), to test cells from MLR cultures that were harvested at the start of the assay (T0), and 24 or 48 h after culture initiation. At all time points tested, there was no difference between treatment groups, showing that apoptosis is not the mechanism by which JWH-015 and O-1966 are suppressing the MLR.

Fig. 8Fig. 8

JWH-015 and O-1966 do not induce apoptosis in the MLR. To determine if the CB2-selective cannabinoids induce apoptosis in the MLR, cells were harvested at time zero, or after 24 or 48 hours in culture. Panel a: cells were stained for activation of caspases 

Discussion

The results presented in this paper show that Δ9-THC, a mixed CB1/CB2 agonist, and two CB2-selective agonists can inhibit the Mixed Lymphocyte Reaction (MLR), an in vitro correlate of organ and skin graft rejection. The inhibition by all three compounds in the MLR was shown to be CB2 dependent, as pretreatment with the CB2-selective antagonist, SR144528, completely reversed the suppression, while pretreatment with the CB1-selective antagonist, SR141716A, had no effect. Further, suppression did not occur in CB2 receptor knock-out (CB2R k/o) mice. In addition, the CB2-selective cannabinoids, JWH-015 and O-1966, decreased the release of IL-2 in the MLR, which did not occur when splenocytes from CB2R k/o mice were used. Evidence is also presented showing that inhibition of the MLR occurred predominantly when the CD3+population, but not the CD11b+ population, was treated with the CB2-selective agonists. This difference was not due to differential expression of the CB2 receptor because before activation, CD3+ cells and CD11b+ cells expressed comparable levels of CB2 mRNA and after activation, CD11b+ cells expressed CB2 mRNA levels many fold higher than CD3+ cells. The CB2 agonists were also shown to inhibit proliferation of purified T-cell populations stimulated with antibodies.

Suppression was observed in the MLR by Δ9-THC, JWH-015, and O-1966, in the range of concentrations from 4 µM to 32 µM. At 32 µM, Δ9-THC suppressed the MLR by 64% ± 0.08, JWH-015 by 62% ± 0.06, and O-1966 by 90.4% ± 0.07. Based on the affinity of these compounds for the CB2 receptor (Δ9-THC: 3.9–75.2 nM (Howlett et al. 2002), JWH-015: 13.8 nM (Showalter et al. 1996), O-1966: 23 nM (Wiley et al. 2002), these doses would seem to be high by several orders of magnitude. However, other investigators have also reported effects on immune function by cannabinoids in this dosage range (Adhikary et al. 2012Borner et al. 2009Ngaotepprutaram et al. 2012Zhu et al. 1993). Previous research has shown that the concentration of Δ9-THC needed to suppress B- and T-lymphocytes in vitro must be increased proportionally to increases of serum levels in the culture media, (Nahas et al. 1977Klein et al. 1985). MLR cultures were incubated in medium containing 10% fetal bovine serum, an amount that necessitated micromolar concentrations of cannabinoids in previous studies. It should be noted that in the present experiments, extensive controls were included to address any concerns about the possibility of cell toxicity, non-receptor mediated or off target effects, or conditions that are not physiological due to the concentrations of cannabinoids used. In every experiment, parallel cultures were stained with Invitrogen’s LIVE/DEAD dead cell stain that was analyzed by flow cytometry. In preliminary experiments trypan blue exclusion was also used as a test of cell viability. In no experiment did any cannabinoid agonist, antagonist, vehicle control, or any combination of agonists, antagonists, and vehicle control increase the number of dead cells compared to cultures that received no treatment. These results show that exposure of the spleen cells to the doses of cannabinoids that resulted in suppression was not toxic, and thus, cell death can be excluded as the cause of the suppression of the MLR. As a further control, apoptosis was also measured in cannabinoid treated MLR cultures by testing levels of several caspases, which are important mediators in the induction of apoptosis. Neither JWH-015 nor O-1966 were found to increase levels of apoptosis in the MLR. In addition, the TUNEL assay, which measures DNA fragmentation seen in apoptotic cells was also employed. Interestingly, all cultures showed marked increases in TUNEL positive cells by 48 hrs in culture, but there was no differential increase in the wells receiving the cannabinoids. The experiments presented in this paper also show that the cannabinoid doses that resulted in immunosuppression, even though seemingly high, were exerting their effect through the CB2 receptor, as suppression was 100% blocked by the CB2-selective antagonist. Further, cells taken from mice lacking the CB2 receptor (CB2R k/o mice) were not suppressed when exposed to the cannabinoids, and the cannabinoids did not inhibit their IL-2 production, showing that these cannabinoids did not have generalized toxicity. Another potential concern is whether the effect of the cannabinoids at these micromolar concentrations is physiologically relevant. Several studies have shown that Δ9-THC and CB2-selective agonists have in vivo immunosuppressive effects. For example, in mice, Δ9-THC inhibited antitumor immunity (5 mg/kg) (Zhu et al. 2000), and increased the Th2 phenotype following Legionella pneumophila infection (8 mg/kg) (Newton et al. 2009). O-1966 has been shown to be effective in treating spinal cord injury (Baty et al. 2008Adhikary et al. 2011) and stroke (Zhang et al. 2007Zhang et al. 2009a) at doses from 1–10 mg/kg. JWH-133, another CB2-selective agonist, was shown to improve outcomes in models of atherosclerosis (Hoyer et al. 2011), systemic sclerosis (Servettaz et al. 2010b), colitis (Storr et al. 2009), stroke (Murikinati et al. 2010), autoimmune uveoretinitis (Xu et al. 2007), and inflammation following LPS challenge (Rajesh et al. 2007Ramirez et al. 2012) at doses from 1–20 mg/kg. We have performed preliminary studies using O-1966 to block skin graft rejection in vivo and found it to be effective at a similar dose range (data not shown). Thus, there seems to be a poor correlation between the doses needed in vitro to demonstrate efficacy of these cannabinoids in the immune system, and the in vivo doses that demonstrate anti-inflammatory and immunosuppressive effects. At present there is no explanation for why such high doses are needed in vitro, and it is not uncommon in pharmacology to see similar situations.

The suppressive effect of Δ9-THC on the MLR and T-cells, the cells that proliferate in the MLR, was previously shown after in vivo administration of Δ9-THC (5 mg/kg), which decreased ex vivo proliferation in the MLR (Zhu et al. 2000). Another group showed that treatment of splenocytes with Δ9-THC in vitro could inhibit proliferation in the MLR, but using CB1/CB2 k/o mice, this group concluded that the inhibition was CB1- and CB2-independent (Springs et al. 2008). Our data show very clearly that Δ9-THC added in vitro inhibits proliferation in the MLR in a CB2-dependent manner, based on both use of receptor specific antagonists and use of cells from CB2 receptor k/o mice. In accordance with our results, several studies have shown that the inhibition of T-cells by cannabinoids to be CB2 mediated. Yuan et al. reported that Δ9-THC treatment decreased mRNA levels for IL-2 and IFN-γ in T-cells activated with anti-CD3 and anti-CD28 antibodies, and that this suppression could be reversed by treatment with the CB2 antagonist SR144528 (Yuan et al. 2002). Other groups used CB2 selective agonists, including JWH-015, and found that they inhibited molecules involved in T-cell receptor signaling in primary human T-cells and Jurkat T-cells following antibody activation (Borner et al. 2009). Other CB2-selective cannabinoids significantly decreased proliferation of T-cells and IL-2 release in response to various methods of stimulation (Cencioni et al. 2010Ihenetu et al. 2003Maresz et al. 2007). Our data clearly demonstrate a direct effect of CB2-selective cannabinoids on T-cells in the context of graft rejection.

Ideally, the anatomically disparate expression of CB1 and CB2 would allow for the use of compounds selective for CB2, and thus eliminate the unwanted psychoactive effects from CB1 activation, while maintaining the anti-inflammatory and immunosuppressive properties. While CB2 receptors have been found to have limited neuronal expression (Gong et al. 2006Van Sickle et al. 2005), recent reports show that CB2 agonists modulate cocaine’s rewarding and locomotor stimulating effects (Xi et al. 2011) and affect symptoms of depression (Onaivi et al. 2008), suggesting a function in the central nervous system for this class of compounds. However, intravenous administration of O-1966 to mice in doses up to 30 mg/kg did not produce any effect in the tetrad test, a common series of behavioral analyses used to assess the psychoactive effects of cannabinoids (Zhang et al. 2007). More work should be done to evaluate the neuronal effects of CB2-selective agonists in order to fully understand the prospect of this class of compounds as potential immunomodulatory therapeutics.

CB2-selective cannabinoids have been proposed as possible candidates to block graft rejection (Nagarkatti et al. 2010), but to date there are no published studies prior to the present one showing that this class of compounds is effective in this regard. The ability to transplant organs has been a major advance in medical science, saving thousands of lives. Previously, the obstacle to achieving graft survival was the inability to prevent immunologic organ rejection between allogeneic donors and recipients. This obstacle was overcome by two critical breakthroughs. First, the development of tissue typing permitted assessment of the relatedness of the MHC antigens of the prospective donor and recipient to determine compatibility. Second was the discovery of immunosuppressive compounds that could be administered chronically to the recipient to prevent rejection. Use of these compounds is required in almost all cases of organ transplantation because an exact tissue match cannot be found, only a close one. Unless immunosuppressive therapy is given, the immune system perceives even the small differences, and eventually mounts an immune response that results in destruction of the graft. The graft is rejected primarily via expansion of activated antigen-specific T-cells that recognize antigens on the incompatible tissue as foreign, and replicate (reviewed by Heeger 2003).

Most current protocols for immunosuppressive therapy use compounds that inhibit T-cells, and a vast majority include calcineurin inhibitors (tacrolimus or cyclosporine) and T-cell depleting antibodies (Colvin-Adams et al. 2013Kandaswamy et al. 2013Kim et al. 2013Smith et al. 2013Valapour et al. 2013). However, the current strategies employing these therapeutic agents have several problems. Even with continuous anti-rejection therapy, eventually many grafts are rejected after several years. Further, the standard anti-rejection drugs tacrolimus and cyclosporine, have been implicated in the development of diabetes, hypertension, and nephrotoxcity (Merville 2005). New therapeutic approaches are needed and CB2-selective agonists could potentially be given alone or in combination with current standard treatments, in order to lower the required doses tacrolimus and cyclosporine.

Further studies to investigate the potential use of CB2-selective cannabinoids as a treatment to prevent graft rejection are desirable. Studies to elucidate the mechanism by which the cannabinoids inhibit T-cells in graft rejection are in progress. Also, the CB2-selective agonists need to be further tested for their capacity to suppress graft rejection in animal transplantation models.

Acknowledgements

This work was supported by Temple University Tobacco Settlement Fund and NIDA grants DA13429, DA06650, and T32-DA07237.

Footnotes

Disclosure

The authors declare that they have no conflict of interest.

Contributor Information

Rebecca Hartzell Robinson, Center for Substance Abuse Research, Temple University School of Medicine, Philadelphia, PA 19140. Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140.
Joseph J. Meissler, Center for Substance Abuse Research, Temple University School of Medicine, Philadelphia, PA 19140. Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140.
Jessica M. Breslow-Deckman, Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia, PA 19107.
John Gaughan, Biostatistics Consulting Center, Temple University School of Medicine, Philadelphia, PA 19140.
Martin W. Adler, Center for Substance Abuse Research, Temple University School of Medicine, Philadelphia, PA 19140. Department of Pharmacology, Temple University School of Medicine, Philadelphia, PA 19140.
Toby K. Eisenstein, Center for Substance Abuse Research, Temple University School of Medicine, Philadelphia, PA 19140. Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140.

References

  • Adhikary S, Kocieda VP, Yen JH, Tuma RF, Ganea D. Signaling through cannabinoid receptor 2 suppresses murine dendritic cell migration by inhibiting matrix metalloproteinase 9 expression. Blood. 2012;120:3741–3749. [PMC free article][PubMed]
  • Adhikary S, Li H, Heller J, Skarica M, Zhang M, Ganea D, Tuma RF. Modulation of inflammatory responses by a cannabinoid-2-selective agonist after spinal cord injury. J Neurotrauma. 2011;28:1–11. [PMC free article]  [PubMed]
  • Baty DE, Zhang M, Li H, Erb CJ, Adler MW, Ganea D, Loftus CM, Jallo JI, Tuma RF. Cannabinoid CB2 receptor activation attenuates motor and autonomic function deficits in a mouse model of spinal cord injury. Clin Neurosurg. 2008;55:172–177.  [PubMed]
  • Borner C, Smida M, Hollt V, Schraven B, Kraus J. Cannabinoid receptor type 1- and 2-mediated increase in cyclic AMP inhibits T cell receptor-triggered signaling. J Biol Chem. 2009;284:35450–35460. [PMC free article]  [PubMed]
  • Cencioni MT, Chiurchiu V, Catanzaro G, Borsellino G, Bernardi G, Battistini L, Maccarrone M. Anandamide suppresses proliferation and cytokine release from primary human T-lymphocytes mainly via CB2 receptors. PLoS ONE [Electronic Resource] 2010;5:e8688. [PMC free article]  [PubMed]
  • Colvin-Adams M, Smith JM, Heubner BM, Skeans MA, Edwards LB, Waller C, Snyder JJ, Israni AK, Kasiske BL. OPTN/SRTR 2011 annual data report: Heart. Am J Transplant. 2013;13:119–148.  [PubMed]
  • Coopman K, Smith LD, Wright KL, Ward SG. Temporal variation in CB2R levels following T lymphocyte activation: Evidence that cannabinoids modulate CXCL12-induced chemotaxis. Int Immunopharm. 2007;7:360–371.  [PubMed]
  • Croxford JL, Yamamura T. Cannabinoids and the immune system: Potential for the treatment of inflammatory diseases? J Neuroimmunol. 2005;166:3–18.  [PubMed]
  • Daaka Y, Friedman H, Klein TW. Cannabinoid receptor proteins are increased in Jurkat, human T-cell line after mitogen activation. J Pharmacol Exp Ther. 1996;276:776–783.[PubMed]
  • Eisenstein TK, Meissler JJ, Wilson Q, Gaughan JP, Adler MW. Anandamide and Δ9-tetrahydrocannabinol directly inhibit cells of the immune system via CB2 receptors. J Neuroimmunol. 2007;189:17–22. [PMC free article]  [PubMed]
  • Fraga D, Raborn ES, Ferreira GA, Cabral GA. Cannabinoids inhibit migration of microglial-like cells to the HIV protein Tat. J Neuroimmune Pharmacol. 2011;6:566–577.  [PubMed]
  • Galiegue S, Mary S, Marchand J, Dussossoy D, Carriere D, Carayon P, Bouaboula M, Shire D, Le Fur G, Casellas P. Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations. Eur J Biochem. 1995;232:54–61.  [PubMed]
  • Ghosh S, Preet A, Groopman JE, Ganju RK. Cannabinoid receptor CB2 modulates the CXCL12/CXCR4-mediated chemotaxis of T lymphocytes. Mol Immunol. 2006;43:2169–2179.  [PubMed]
  • Gong JP, Onaivi ES, Ishiguro H, Liu QR, Tagliaferro PA, Brusco A, Uhl GR. Cannabinoid CB2 receptors: Immunohistochemical localization in rat brain. Brain Res. 2006;1071:10–23.  [PubMed]
  • Gupta S, Grieco MH, Cushman P. Impairment of rosette-forming T lymphocytes in chronic marihuana smokers. N Engl J Med. 1974;291:874–877.  [PubMed]
  • Heeger PS. T-cell allorecognition and transplant rejection: A summary and update. Am J Transplant. 2003;3:525–533.  [PubMed]
  • Herkenham M, Lynn AB, Johnson MR, Melvin LS, de Costa BR, Rice KC. Characterization and localization of cannabinoid receptors in rat brain: A quantitative in vitro autoradiographic study. J Neurosci. 1991;11:563–583.  [PubMed]
  • Howlett AC, Barth F, Bonner TI, Cabral G, Casellas P, Devane WA, Felder CC, Herkenham M, Mackie K, Martin BR, Mechoulam R, Pertwee RG. International union of pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol Rev. 2002;54:161–202.  [PubMed]
  • Hoyer FF, Steinmetz M, Zimmer S, Becker A, Lutjohann D, Buchalla R, Zimmer A, Nickenig G. Atheroprotection via cannabinoid receptor-2 is mediated by circulating and vascular cells in vivo. J Mol Cell Cardiol. 2011;51:1007–1014.  [PubMed]
  • Huffman JW, Liddle J, Yu S, Aung MM, Abood ME, Wiley JL, Martin BR. 3-(1′,1′-dimethylbutyl)-1-deoxy-Δ8-THC and related compounds: Synthesis of selective ligands for the CB2 receptor. Bioorg Med Chem. 1999;7:2905–2914.  [PubMed]
  • Huffman JW, Yu S, Showalter V, Abood ME, Wiley JL, Compton DR, Martin BR, Bramblett RD, Reggio PH. Synthesis and pharmacology of a very potent cannabinoid lacking a phenolic hydroxyl with high affinity for the CB2 receptor. J Med Chem. 1996;39:3875–3877.  [PubMed]
  • Huffman JW, Zengin G, Wu MJ, Lu J, Hynd G, Bushell K, Thompson AL, Bushell S, Tartal C, Hurst DP, Reggio PH, Selley DE, Cassidy MP, Wiley JL, Martin BR. Structure-activity relationships for 1-alkyl-3-(1-naphthoyl)indoles at the cannabinoid CB(1) and CB(2) receptors: Steric and electronic effects of naphthoyl substituents. new highly selective CB(2) receptor agonists. Bioorg Med Chem. 2005;13:89–112.  [PubMed]
  • Ihenetu K, Molleman A, Parsons M, Whelan C. Pharmacological characterisation of cannabinoid receptors inhibiting interleukin 2 release from human peripheral blood mononuclear cells. Eur J Pharmacol. 2003;464:207–215.  [PubMed]
  • Johnson RJ, Wiersema V. Repression of bone marrow leukopoiesis by Δ9-tetrahydrocannabinol (Δ9-THC) Res Commun Chem Pathol Pharmacol. 1974;7:613–616.  [PubMed]
  • Kandaswamy R, Stock PG, Skeans MA, Gustafson SK, Sleeman EF, Wainright JL, Carrico RJ, Ghimire V, Snyder JJ, Israni AK, Kasiske BL. OPTN/SRTR 2011 annual data report: Pancreas. Am J Transplant. 2013;13:47–72.  [PubMed]
  • Kim WR, Stock PG, Smith JM, Heimbach JK, Skeans MA, Edwards EB, Harper AM, Snyder JJ, Israni AK, Kasiske BL. OPTN/SRTR 2011 annual data report: Liver. Am J Transplant. 2013;13:73–102.  [PubMed]
  • Klein TW, Cabral GA. Cannabinoid-induced immune suppression and modulation of antigen-presenting cells. J Neuroimm Pharmacol. 2006;1:50–64.  [PubMed]
  • Klein TW, Newton C, Larsen K, Lu L, Perkins I, Nong L, Friedman H. The cannabinoid system and immune modulation. J Leukoc Biol. 2003;74:486–96.  [PubMed]
  • Klein TW, Newton CA, Widen R, Friedman H. The effect of delta-9-tetrahydrocannabinol and 11-hydroxy-delta-9-tetrahydrocannabinol on T-lymphocyte and B-lymphocyte mitogen responses. J.Immunopharmac. 1985;7:451–66.  [PubMed]
  • Lombard C, Nagarkatti M, Nagarkatti P. CB2 cannabinoid receptor agonist, JWH-015, triggers apoptosis in immune cells: Potential role for CB2-selective ligands as immunosuppressive agents. Clin Immunol. 2007;122:259–270. [PMC free article][PubMed]
  • Maresz K, Pryce G, Ponomarev ED, Marsicano G, Croxford JL, Shriver LP, Ledent C, Cheng X, Carrier EJ, Mann MK, Giovannoni G, Pertwee RG, Yamamura T, Buckley NE, Hillard CJ, Lutz B, Baker D, Dittel BN. Direct suppression of CNS autoimmune inflammation via the cannabinoid receptor CB1 on neurons and CB2 on autoreactive T cells. Nature Med. 2007;13:492–497.  [PubMed]
  • Marriott KS, Huffman JW, Wiley JL, Martin BR. Synthesis and pharmacology of 11-nor-1-methoxy-9-hydroxyhexahydrocannabinols and 11-nor-1-deoxy-9-hydroxyhexahydrocannabinols: New selective ligands for the cannabinoid CB2 receptor. Bioorg Med Chem. 2006;14:2386–2397.  [PubMed]
  • Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, Bonner TI. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature. 1990;346:561–564.  [PubMed]
  • McCoy KL, Matveyeva M, Carlisle SJ, Cabral GA. Cannabinoid inhibition of the processing of intact lysozyme by macrophages: Evidence for CB2 receptor participation. J Pharmacol Exp Ther. 1999;289:1620–1625.  [PubMed]
  • McKallip RJ, Lombard C, Martin BR, Nagarkatti M, Nagarkatti PS. Δ9-tetrahydrocannabinol-induced apoptosis in the thymus and spleen as a mechanism of immunosuppression in vitro and in vivo. J Pharmacol Exp Ther. 2002;302:451–465.[PubMed]
  • Merville P. Combating chronic renal allograft dysfunction: Optimal immunosuppressive regimens. Drugs. 2005;65:615–631.  [PubMed]
  • Munro S, Thomas KK, Abu-Shaar M. Molecular characterization of a peripheral receptor for cannabinoids. Nature. 1993;365:61–65.  [PubMed]
  • Murikinati S, Jüttler E, Keinert T, Ridder DA, Muhammad S, Waibler Z, Ledent C, Zimmer A, Kalinke U, Schwaninger M. Activation of cannabinoid 2 receptors protects against cerebral ischemia by inhibiting neutrophil recruitment. FASEB J. 2010;24:788–798.  [PubMed]
  • Nagarkatti M, Rieder SA, Hegde VL, Kanada S, Nagarkatti P. Do cannabinoids have a therapeutic role in transplantation? Trends Pharmacol Sci. 2010;31:345–350.[PMC free article]  [PubMed]
  • Nahas GG, Morishima A, Desoize B. Effects of cannabinoids on macromolecular synthesis and replication of cultured lymphocytes. Fed Proc. 1977;36:1748–1752.[PubMed]
  • Nahas GG, Suciu-Foca N, Armand JP, Morishima A. Inhibition of cellular mediated immunity in marihuana smokers. Science. 1974;183:419–420.  [PubMed]
  • Neu RL, Powers HO, King S, Gardner LI. Δ8- and Δ9-tetrahydrocannabinol: Effects on cultured human leucocytes. J Clin Pharmacol New Drugs. 1970;10:228–230.  [PubMed]
  • Newton CA, Chou JP, Perkins I, Klein TW. CB1 and CB2 cannabinoid receptors mediate different aspects of Δ9-tetrahydrocannabinol (THC)-induced T helper cell shift following immune activation by Legionella pneumophila infection. J Neuroimm Pharmacol. 2009;4:92–102.  [PubMed]
  • Ngaotepprutaram T, Kaplan BL, Crawford RB, Kaminski NE. Differential modulation by Δ9-tetrahydrocannabinol (Δ9-THC) of CD40 ligand (CD40L) expression in activated mouse splenic CD4+ T cells. J Neuroimmune Pharmacol. 2012;7:969–980.[PMC free article]  [PubMed]
  • Ni X, Geller EB, Eppihimer MJ, Eisenstein TK, Adler MW, Tuma RF. Win 55212-2, a cannabinoid receptor agonist, attenuates leukocyte/endothelial interactions in an experimental autoimmune encephalomyelitis mode. Mult Scler. 2004;10:158–164.[PubMed]
  • Ofek O, Karsak M, Leclerc N, Fogel M, Frenkel B, Wright K, Tam J, Attar-Namdar M, Kram V, Shohami E, Mechoulam R, Zimmer A, Bab I. Peripheral cannabinoid receptor, CB2, regulates bone mass. Proc Natl Acad Sci USA. 2006;103:696–701.[PMC free article]  [PubMed]
  • Onaivi ES, Ishiguro H, Gong JP, Patel S, Meozzi PA, Myers L, Perchuk A, Mora Z, Tagliaferro PA, Gardner E, Brusco A, Akinshola BE, Liu QR, Chirwa SS, Hope B, Lujilde J, Inada T, Iwasaki S, Macharia D, Teasenfitz L, Arinami T, Uhl GR. Functional expression of brain neuronal CB2 cannabinoid receptors are involved in the effects of drugs of abuse and in depression. Ann N Y Acad Sci. 2008;1139:434–449.[PMC free article]  [PubMed]
  • Rajesh M, Mukhopadhyay P, Bátkai S, Haskó G, Liaudet L, Huffman JW, Csiszar A, Ungvari Z, Mackie K, Chatterjee S, Pacher P. CB2-receptor stimulation attenuates TNF-α-induced human endothelial cell activation, transendothelial migration of monocytes, and monocyte-endothelial adhesion. Am J Physiol. 2007;293:H2210–H2218.[PMC free article]  [PubMed]
  • Ramirez SH, Hasko J, Skuba A, Fan S, Dykstra H, McCormick R, Reichenbach N, Krizbai I, Mahedevan A, Zhang M, Tuma R, Son YJ, Persidsky Y. Activation of cannabinoid receptor 2 attenuates leukocyte-endothelial cell interactions and blood-brain barrier dysfunction under inflammatory conditions. J Neurosci. 2012;32:4004–4016. [PMC free article]  [PubMed]
  • Roth MD. Effects of Δ9-tetrahydrocannabinol on human immune function and host defense. Chem Phys Lipids. 2002;121:229–239.  [PubMed]
  • Servettaz A, Kavian N, Nicco C, Deveaux V, Chereau C, Wang A, Zimmer A, Lotersztajn S, Weill B, Batteux F. Targeting the cannabinoid pathway limits the development of fibrosis and autoimmunity in a mouse model of systemic sclerosis. Am J Pathol. 2010a;177:187–196. [PMC free article]  [PubMed]
  • Servettaz A, Kavian N, Nicco C, Deveaux V, Chereau C, Wang A, Zimmer A, Lotersztajn S, Weill B, Batteux F. Targeting the cannabinoid pathway limits the development of fibrosis and autoimmunity in a mouse model of systemic sclerosis. Am J Pathol. 2010b;177:187–196. [PMC free article]  [PubMed]
  • Showalter VM, Compton DR, Martin BR, Abood ME. Evaluation of binding in a transfected cell line expressing a peripheral cannabinoid receptor (CB2): Identification of cannabinoid receptor subtype selective ligands. J Pharmacol Exp Ther. 1996;278:989–999.  [PubMed]
  • Smith JM, Skeans MA, Thompson B, Horslen SP, Edwards EB, Harper AM, Snyder JJ, Israni AK, Kasiske BL. OPTN/SRTR 2011 annual data report: Intestine. Am J Transplant. 2013;13:103–118.  [PubMed]
  • Springs AEB, Karmaus PWF, Crawford RB, Kaplan BLF, Kaminski NE. Effects of targeted deletion of cannabinoid receptors CB1 and CB2 on immune competence and sensitivity to immune modulation by Δ9-tetrahydrocannabinol. J Leukoc Biol. 2008;84:1574–1584. [PMC free article]  [PubMed]
  • Storr MA, Keenan CM, Zhang H, Patel KD, Makriyannis A, Sharkey KA. Activation of the cannabinoid 2 receptor (CB2) protects against experimental colitis. Inflamm Bowel Dis. 2009;15:1678–1685.  [PubMed]
  • Sumariwalla PF, Gallily R, Tchilibon S, Fride E, Mechoulam R, Feldmann M. A novel synthetic, nonpsychoactive cannabinoid acid (HU-320) with antiinflammatory properties in murine collagen-induced arthritis. Arthritis Rheum. 2004;50:985–998.[PubMed]
  • Tschöp J, Kasten KR, Nogueiras R, Goetzman HS, Cave CM, England LG, Dattilo J, Lentsch AB, Tschöp MH, Caldwell CC. The cannabinoid receptor 2 is critical for the host response to sepsis. J Immunol. 2009;183:499–505. [PMC free article]  [PubMed]
  • Valapour M, Paulson K, Smith JM, Hertz MI, Skeans MA, Heubner BM, Edwards LB, Snyder JJ, Israni AK, Kasiske BL. OPTN/SRTR 2011 annual data report: Lung. Am J Transplant. 2013;13:149–177.  [PubMed]
  • Van Sickle MD, Duncan M, Kingsley PJ, Mouihate A, Urbani P, Mackie K, Stella N, Patel KD, Sharkey KA. Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science. 2005;3100:329–332.  [PubMed]
  • Waksman Y, Olson JM, Carlisle SJ, Cabral GA. The central cannabinoid receptor (CB1) mediates inhibition of nitric oxide production by rat microglial cells. J Pharmacol Exp Ther. 1999;288:1357–1366.  [PubMed]
  • Wiley JL, Beletskaya ID, Ng EW, Dai Z, Crocker PJ, Mahadevan A, Razdan RK, Martin BR. Resorcinol derivatives: A novel template for the development of cannabinoid CB(1)/CB(2) and CB(2)-selective agonists. J Pharmacol Exp Ther. 2002;301:679–689.  [PubMed]
  • Xi ZX, Peng XQ, Li X, Song R, Zhang HY, Liu QR, Yang HJ, Bi GH, Li J, Gardner EL. Brain cannabinoid CB2 receptors modulate cocaine’s actions in mice. Nat Neurosci. 2011;14:1160–1166. [PMC free article]  [PubMed]
  • Xu H, Cheng CL, Chen M, Manivannan A, Cabay L, Pertwee RG, Coutts A, Forrester JV. Anti-inflammatory property of the cannabinoid receptor-2-selective agonist JWH-133 in a rodent model of autoimmune uveoretinitis. J Leukoc Biol. 2007;82:532–541.[PubMed]
  • Yuan M, Kiertscher SM, Cheng Q, Zoumalan R, Tashkin DP, Roth MD. Δ9-tetrahydrocannabinol regulates Th1/Th2 cytokine balance in activated human T cells. J Neuroimmunol. 2002;133:124–131.  [PubMed]
  • Zhang M, Martin BR, Adler MW, Razdan RK, Jallo JI, Tuma RF. Cannabinoid CB2 receptor activation decreases cerebral infarction in a mouse focal ischemia/reperfusion model. J Cereb Blood Flow Metab. 2007;27:1387–1396. [PMC free article]  [PubMed]
  • Zhang M, Adler MW, Abood ME, Ganea D, Jallo J, Tuma RF. CB2 receptor activation attenuates microcirculatory dysfunction during cerebral ischemic/reperfusion injury. Microvasc Res. 2009a;78:86–94. [PMC free article]  [PubMed]
  • Zhang M, Martin BR, Adler MW, Razdan RJ, Kong W, Ganea D, Tuma RF. Modulation of cannabinoid receptor activation as a neuroprotective strategy for EAE and stroke. J Neuroimm Pharmacol. 2009b;4:249–259. [PMC free article]  [PubMed]
  • Zhu LX, Sharma S, Stolina M, Gardner B, Roth MD, Tashkin DP, Dubinett SM. Δ9-tetrahydrocannabinol inhibits antitumor immunity by a CB2 receptor-mediated, cytokine-dependent pathway. J Immunol. 2000;165:373–380.  [PubMed]
  • Zhu W, Igarashi T, Qi ZT, Newton C, Widen RE, Friedman H, Klein TW. Δ9-tetrahydrocannabinol (THC) decreases the number of high and intermediate affinity IL-2 receptors of the IL-2 dependent cell line NKB61A2. Int J Immunopharmacol. 1993;15:401–408.  [PubMed]
potp font 1
NPFP7FB